ID: 1191226857

View in Genome Browser
Species Human (GRCh38)
Location X:58053273-58053295
Sequence CCAGTACCACACTAAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191226857_1191226861 7 Left 1191226857 X:58053273-58053295 CCCTGTGCTTAGTGTGGTACTGG No data
Right 1191226861 X:58053303-58053325 TTAGTCCTAAGAAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191226857 Original CRISPR CCAGTACCACACTAAGCACA GGG (reversed) Intergenic
No off target data available for this crispr