ID: 1191226861

View in Genome Browser
Species Human (GRCh38)
Location X:58053303-58053325
Sequence TTAGTCCTAAGAAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191226855_1191226861 15 Left 1191226855 X:58053265-58053287 CCTTAGATCCCTGTGCTTAGTGT No data
Right 1191226861 X:58053303-58053325 TTAGTCCTAAGAAAAATTTCTGG No data
1191226859_1191226861 6 Left 1191226859 X:58053274-58053296 CCTGTGCTTAGTGTGGTACTGGT No data
Right 1191226861 X:58053303-58053325 TTAGTCCTAAGAAAAATTTCTGG No data
1191226857_1191226861 7 Left 1191226857 X:58053273-58053295 CCCTGTGCTTAGTGTGGTACTGG No data
Right 1191226861 X:58053303-58053325 TTAGTCCTAAGAAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191226861 Original CRISPR TTAGTCCTAAGAAAAATTTC TGG Intergenic
No off target data available for this crispr