ID: 1191233547

View in Genome Browser
Species Human (GRCh38)
Location X:58116329-58116351
Sequence ATAGACACCTTGGCAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191233545_1191233547 -5 Left 1191233545 X:58116311-58116333 CCTCAGGAATTTAATGTTATAGA No data
Right 1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG No data
1191233542_1191233547 16 Left 1191233542 X:58116290-58116312 CCAGGAGAGACTCATGGCCAACC No data
Right 1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG No data
1191233544_1191233547 -1 Left 1191233544 X:58116307-58116329 CCAACCTCAGGAATTTAATGTTA No data
Right 1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG No data
1191233540_1191233547 28 Left 1191233540 X:58116278-58116300 CCAGGCATTCTACCAGGAGAGAC No data
Right 1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191233547 Original CRISPR ATAGACACCTTGGCAACAAC AGG Intergenic
No off target data available for this crispr