ID: 1191239554

View in Genome Browser
Species Human (GRCh38)
Location X:58173094-58173116
Sequence ATTTTGAAGCCCAATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191239551_1191239554 18 Left 1191239551 X:58173053-58173075 CCAGGTTGGTAACACTCTTTTTA No data
Right 1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191239554 Original CRISPR ATTTTGAAGCCCAATGAGTT AGG Intergenic
No off target data available for this crispr