ID: 1191241380

View in Genome Browser
Species Human (GRCh38)
Location X:58192660-58192682
Sequence AAAGACTCCTGGTGAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191241378_1191241380 -4 Left 1191241378 X:58192641-58192663 CCATGGCTATTCTAATGGAAAAG No data
Right 1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG No data
1191241376_1191241380 5 Left 1191241376 X:58192632-58192654 CCTTGACGACCATGGCTATTCTA No data
Right 1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191241380 Original CRISPR AAAGACTCCTGGTGAAAACC AGG Intergenic
No off target data available for this crispr