ID: 1191244136

View in Genome Browser
Species Human (GRCh38)
Location X:58212599-58212621
Sequence TGGCGATATCAGGCATTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191244128_1191244136 15 Left 1191244128 X:58212561-58212583 CCTGGCCAGCCCCAGGTATTCTA No data
Right 1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG No data
1191244129_1191244136 10 Left 1191244129 X:58212566-58212588 CCAGCCCCAGGTATTCTAAAGAT No data
Right 1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG No data
1191244130_1191244136 6 Left 1191244130 X:58212570-58212592 CCCCAGGTATTCTAAAGATAGAG No data
Right 1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG No data
1191244132_1191244136 4 Left 1191244132 X:58212572-58212594 CCAGGTATTCTAAAGATAGAGAC No data
Right 1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG No data
1191244131_1191244136 5 Left 1191244131 X:58212571-58212593 CCCAGGTATTCTAAAGATAGAGA No data
Right 1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191244136 Original CRISPR TGGCGATATCAGGCATTCTT AGG Intergenic
No off target data available for this crispr