ID: 1191245772

View in Genome Browser
Species Human (GRCh38)
Location X:58227121-58227143
Sequence GTCTCTTCCATTAGAATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191245772_1191245777 5 Left 1191245772 X:58227121-58227143 CCAACCATTCTAATGGAAGAGAC No data
Right 1191245777 X:58227149-58227171 GCTGACTCCAGGCATTCTAGTGG No data
1191245772_1191245781 29 Left 1191245772 X:58227121-58227143 CCAACCATTCTAATGGAAGAGAC No data
Right 1191245781 X:58227173-58227195 AGATACTCCAGGCCTATCCCAGG No data
1191245772_1191245775 -6 Left 1191245772 X:58227121-58227143 CCAACCATTCTAATGGAAGAGAC No data
Right 1191245775 X:58227138-58227160 AGAGACTCCTGGCTGACTCCAGG No data
1191245772_1191245778 6 Left 1191245772 X:58227121-58227143 CCAACCATTCTAATGGAAGAGAC No data
Right 1191245778 X:58227150-58227172 CTGACTCCAGGCATTCTAGTGGG No data
1191245772_1191245780 18 Left 1191245772 X:58227121-58227143 CCAACCATTCTAATGGAAGAGAC No data
Right 1191245780 X:58227162-58227184 ATTCTAGTGGGAGATACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191245772 Original CRISPR GTCTCTTCCATTAGAATGGT TGG (reversed) Intergenic
No off target data available for this crispr