ID: 1191248015

View in Genome Browser
Species Human (GRCh38)
Location X:58243285-58243307
Sequence CACCCAGTAGTCTCTTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191248015_1191248017 -5 Left 1191248015 X:58243285-58243307 CCAGCCAAAGAGACTACTGGGTG No data
Right 1191248017 X:58243303-58243325 GGGTGACCCCAGACATTCTAAGG No data
1191248015_1191248021 9 Left 1191248015 X:58243285-58243307 CCAGCCAAAGAGACTACTGGGTG No data
Right 1191248021 X:58243317-58243339 ATTCTAAGGATAGTGACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191248015 Original CRISPR CACCCAGTAGTCTCTTTGGC TGG (reversed) Intergenic
No off target data available for this crispr