ID: 1191249534

View in Genome Browser
Species Human (GRCh38)
Location X:58253852-58253874
Sequence GGTCGTCCATGGTAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191249522_1191249534 21 Left 1191249522 X:58253808-58253830 CCCCATGATCCCACGGGGCCAGT No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249527_1191249534 12 Left 1191249527 X:58253817-58253839 CCCACGGGGCCAGTGCAGGGCAG No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249528_1191249534 11 Left 1191249528 X:58253818-58253840 CCACGGGGCCAGTGCAGGGCAGC No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249518_1191249534 28 Left 1191249518 X:58253801-58253823 CCAGGGACCCCATGATCCCACGG No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249523_1191249534 20 Left 1191249523 X:58253809-58253831 CCCATGATCCCACGGGGCCAGTG No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249531_1191249534 3 Left 1191249531 X:58253826-58253848 CCAGTGCAGGGCAGCTGGGAAGT No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data
1191249524_1191249534 19 Left 1191249524 X:58253810-58253832 CCATGATCCCACGGGGCCAGTGC No data
Right 1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191249534 Original CRISPR GGTCGTCCATGGTAGCACCC AGG Intergenic
No off target data available for this crispr