ID: 1191251026

View in Genome Browser
Species Human (GRCh38)
Location X:58260277-58260299
Sequence ACCAGGCCCTTGGGGGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191251018_1191251026 -8 Left 1191251018 X:58260262-58260284 CCCAGCAGCACCTGCACCAGGCC No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data
1191251013_1191251026 22 Left 1191251013 X:58260232-58260254 CCTCGGTCATCCCACAGATGACC No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data
1191251016_1191251026 1 Left 1191251016 X:58260253-58260275 CCATGACTTCCCAGCAGCACCTG No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data
1191251015_1191251026 11 Left 1191251015 X:58260243-58260265 CCACAGATGACCATGACTTCCCA No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data
1191251019_1191251026 -9 Left 1191251019 X:58260263-58260285 CCAGCAGCACCTGCACCAGGCCC No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data
1191251014_1191251026 12 Left 1191251014 X:58260242-58260264 CCCACAGATGACCATGACTTCCC No data
Right 1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191251026 Original CRISPR ACCAGGCCCTTGGGGGTCTT GGG Intergenic
No off target data available for this crispr