ID: 1191251898

View in Genome Browser
Species Human (GRCh38)
Location X:58263799-58263821
Sequence TGATTGTCCCCTTCTTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191251898_1191251905 4 Left 1191251898 X:58263799-58263821 CCCCCGGAAGAAGGGGACAATCA No data
Right 1191251905 X:58263826-58263848 GCTCAGGAAAAACAGCAGCGAGG No data
1191251898_1191251907 21 Left 1191251898 X:58263799-58263821 CCCCCGGAAGAAGGGGACAATCA No data
Right 1191251907 X:58263843-58263865 GCGAGGCCGAGTGCTAGGCCTGG No data
1191251898_1191251906 16 Left 1191251898 X:58263799-58263821 CCCCCGGAAGAAGGGGACAATCA No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data
1191251898_1191251908 22 Left 1191251898 X:58263799-58263821 CCCCCGGAAGAAGGGGACAATCA No data
Right 1191251908 X:58263844-58263866 CGAGGCCGAGTGCTAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191251898 Original CRISPR TGATTGTCCCCTTCTTCCGG GGG (reversed) Intergenic
No off target data available for this crispr