ID: 1191251902

View in Genome Browser
Species Human (GRCh38)
Location X:58263802-58263824
Sequence CCCTGATTGTCCCCTTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191251902_1191251905 1 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251905 X:58263826-58263848 GCTCAGGAAAAACAGCAGCGAGG No data
1191251902_1191251906 13 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data
1191251902_1191251908 19 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251908 X:58263844-58263866 CGAGGCCGAGTGCTAGGCCTGGG No data
1191251902_1191251910 30 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251910 X:58263855-58263877 GCTAGGCCTGGGTCCTCTCATGG No data
1191251902_1191251907 18 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251907 X:58263843-58263865 GCGAGGCCGAGTGCTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191251902 Original CRISPR CCCTGATTGTCCCCTTCTTC CGG (reversed) Intergenic
No off target data available for this crispr