ID: 1191251906

View in Genome Browser
Species Human (GRCh38)
Location X:58263838-58263860
Sequence CAGCAGCGAGGCCGAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191251899_1191251906 15 Left 1191251899 X:58263800-58263822 CCCCGGAAGAAGGGGACAATCAG No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data
1191251900_1191251906 14 Left 1191251900 X:58263801-58263823 CCCGGAAGAAGGGGACAATCAGG No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data
1191251902_1191251906 13 Left 1191251902 X:58263802-58263824 CCGGAAGAAGGGGACAATCAGGG No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data
1191251898_1191251906 16 Left 1191251898 X:58263799-58263821 CCCCCGGAAGAAGGGGACAATCA No data
Right 1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191251906 Original CRISPR CAGCAGCGAGGCCGAGTGCT AGG Intergenic
No off target data available for this crispr