ID: 1191255203

View in Genome Browser
Species Human (GRCh38)
Location X:58276689-58276711
Sequence CAGGGGAAGGTTGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255203_1191255212 7 Left 1191255203 X:58276689-58276711 CCGGCCTCCTCAACCTTCCCCTG No data
Right 1191255212 X:58276719-58276741 GGACGCCTGTCTCCATCCCCCGG No data
1191255203_1191255213 8 Left 1191255203 X:58276689-58276711 CCGGCCTCCTCAACCTTCCCCTG No data
Right 1191255213 X:58276720-58276742 GACGCCTGTCTCCATCCCCCGGG No data
1191255203_1191255220 27 Left 1191255203 X:58276689-58276711 CCGGCCTCCTCAACCTTCCCCTG No data
Right 1191255220 X:58276739-58276761 CGGGAAACTTCTTGCCGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255203 Original CRISPR CAGGGGAAGGTTGAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr