ID: 1191255306

View in Genome Browser
Species Human (GRCh38)
Location X:58277090-58277112
Sequence CAGGGAAAGGTTGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255306_1191255323 27 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255306_1191255315 8 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255306_1191255324 28 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255324 X:58277141-58277163 GGGGGACTTCTTGCTGCTTTGGG No data
1191255306_1191255314 7 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255306_1191255316 9 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255306_1191255317 10 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255317 X:58277123-58277145 CGCCTGTCATTGTCCCCCGGGGG No data
1191255306_1191255325 29 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255325 X:58277142-58277164 GGGGACTTCTTGCTGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255306 Original CRISPR CAGGGAAAGGTTGAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr