ID: 1191255314

View in Genome Browser
Species Human (GRCh38)
Location X:58277120-58277142
Sequence GGACGCCTGTCATTGTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255308_1191255314 0 Left 1191255308 X:58277097-58277119 CCTCAACCTTTCCCTGAAAGCCT No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255310_1191255314 -6 Left 1191255310 X:58277103-58277125 CCTTTCCCTGAAAGCCTGGACGC No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255306_1191255314 7 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255307_1191255314 3 Left 1191255307 X:58277094-58277116 CCTCCTCAACCTTTCCCTGAAAG No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255305_1191255314 23 Left 1191255305 X:58277074-58277096 CCTCTAGTGGGGTACGCCGGCCT No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255302_1191255314 29 Left 1191255302 X:58277068-58277090 CCCTGACCTCTAGTGGGGTACGC No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data
1191255303_1191255314 28 Left 1191255303 X:58277069-58277091 CCTGACCTCTAGTGGGGTACGCC No data
Right 1191255314 X:58277120-58277142 GGACGCCTGTCATTGTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255314 Original CRISPR GGACGCCTGTCATTGTCCCC CGG Intergenic
No off target data available for this crispr