ID: 1191255315

View in Genome Browser
Species Human (GRCh38)
Location X:58277121-58277143
Sequence GACGCCTGTCATTGTCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255310_1191255315 -5 Left 1191255310 X:58277103-58277125 CCTTTCCCTGAAAGCCTGGACGC No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255307_1191255315 4 Left 1191255307 X:58277094-58277116 CCTCCTCAACCTTTCCCTGAAAG No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255302_1191255315 30 Left 1191255302 X:58277068-58277090 CCCTGACCTCTAGTGGGGTACGC No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255306_1191255315 8 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255305_1191255315 24 Left 1191255305 X:58277074-58277096 CCTCTAGTGGGGTACGCCGGCCT No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255311_1191255315 -10 Left 1191255311 X:58277108-58277130 CCCTGAAAGCCTGGACGCCTGTC No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255308_1191255315 1 Left 1191255308 X:58277097-58277119 CCTCAACCTTTCCCTGAAAGCCT No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data
1191255303_1191255315 29 Left 1191255303 X:58277069-58277091 CCTGACCTCTAGTGGGGTACGCC No data
Right 1191255315 X:58277121-58277143 GACGCCTGTCATTGTCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255315 Original CRISPR GACGCCTGTCATTGTCCCCC GGG Intergenic
No off target data available for this crispr