ID: 1191255316

View in Genome Browser
Species Human (GRCh38)
Location X:58277122-58277144
Sequence ACGCCTGTCATTGTCCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255311_1191255316 -9 Left 1191255311 X:58277108-58277130 CCCTGAAAGCCTGGACGCCTGTC No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255312_1191255316 -10 Left 1191255312 X:58277109-58277131 CCTGAAAGCCTGGACGCCTGTCA No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255310_1191255316 -4 Left 1191255310 X:58277103-58277125 CCTTTCCCTGAAAGCCTGGACGC No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255307_1191255316 5 Left 1191255307 X:58277094-58277116 CCTCCTCAACCTTTCCCTGAAAG No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255308_1191255316 2 Left 1191255308 X:58277097-58277119 CCTCAACCTTTCCCTGAAAGCCT No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255303_1191255316 30 Left 1191255303 X:58277069-58277091 CCTGACCTCTAGTGGGGTACGCC No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255306_1191255316 9 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data
1191255305_1191255316 25 Left 1191255305 X:58277074-58277096 CCTCTAGTGGGGTACGCCGGCCT No data
Right 1191255316 X:58277122-58277144 ACGCCTGTCATTGTCCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255316 Original CRISPR ACGCCTGTCATTGTCCCCCG GGG Intergenic
No off target data available for this crispr