ID: 1191255323

View in Genome Browser
Species Human (GRCh38)
Location X:58277140-58277162
Sequence CGGGGGACTTCTTGCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255308_1191255323 20 Left 1191255308 X:58277097-58277119 CCTCAACCTTTCCCTGAAAGCCT No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255307_1191255323 23 Left 1191255307 X:58277094-58277116 CCTCCTCAACCTTTCCCTGAAAG No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255312_1191255323 8 Left 1191255312 X:58277109-58277131 CCTGAAAGCCTGGACGCCTGTCA No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255311_1191255323 9 Left 1191255311 X:58277108-58277130 CCCTGAAAGCCTGGACGCCTGTC No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255318_1191255323 -8 Left 1191255318 X:58277125-58277147 CCTGTCATTGTCCCCCGGGGGAC No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255313_1191255323 0 Left 1191255313 X:58277117-58277139 CCTGGACGCCTGTCATTGTCCCC No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255306_1191255323 27 Left 1191255306 X:58277090-58277112 CCGGCCTCCTCAACCTTTCCCTG No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data
1191255310_1191255323 14 Left 1191255310 X:58277103-58277125 CCTTTCCCTGAAAGCCTGGACGC No data
Right 1191255323 X:58277140-58277162 CGGGGGACTTCTTGCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255323 Original CRISPR CGGGGGACTTCTTGCTGCTT TGG Intergenic
No off target data available for this crispr