ID: 1191255933

View in Genome Browser
Species Human (GRCh38)
Location X:58279646-58279668
Sequence CAGCCCCCGCACCCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191255933_1191255942 12 Left 1191255933 X:58279646-58279668 CCCTGGGTGGGGTGCGGGGGCTG No data
Right 1191255942 X:58279681-58279703 TGACCCCTGATGGGGCACGCCGG No data
1191255933_1191255940 4 Left 1191255933 X:58279646-58279668 CCCTGGGTGGGGTGCGGGGGCTG No data
Right 1191255940 X:58279673-58279695 GGAGGCCGTGACCCCTGATGGGG No data
1191255933_1191255938 2 Left 1191255933 X:58279646-58279668 CCCTGGGTGGGGTGCGGGGGCTG No data
Right 1191255938 X:58279671-58279693 AAGGAGGCCGTGACCCCTGATGG No data
1191255933_1191255939 3 Left 1191255933 X:58279646-58279668 CCCTGGGTGGGGTGCGGGGGCTG No data
Right 1191255939 X:58279672-58279694 AGGAGGCCGTGACCCCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191255933 Original CRISPR CAGCCCCCGCACCCCACCCA GGG (reversed) Intergenic
No off target data available for this crispr