ID: 1191256280

View in Genome Browser
Species Human (GRCh38)
Location X:58280986-58281008
Sequence CTCCATGCCCCCAGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191256270_1191256280 19 Left 1191256270 X:58280944-58280966 CCTTCAGTGGGGGAGACACACAC No data
Right 1191256280 X:58280986-58281008 CTCCATGCCCCCAGTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191256280 Original CRISPR CTCCATGCCCCCAGTGGGTT GGG Intergenic
No off target data available for this crispr