ID: 1191268452

View in Genome Browser
Species Human (GRCh38)
Location X:58429515-58429537
Sequence CAGGATAAAAACAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191268452_1191268456 1 Left 1191268452 X:58429515-58429537 CCTTCCTTCTTGTTTTTATCCTG No data
Right 1191268456 X:58429539-58429561 AATATTCACTTTTTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191268452 Original CRISPR CAGGATAAAAACAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr