ID: 1191269150

View in Genome Browser
Species Human (GRCh38)
Location X:58440185-58440207
Sequence CAGGGTAAAAACTAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191269150_1191269157 1 Left 1191269150 X:58440185-58440207 CCTTCCTTCTAGTTTTTACCCTG No data
Right 1191269157 X:58440209-58440231 GATATTGGCTTTTTCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191269150 Original CRISPR CAGGGTAAAAACTAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr