ID: 1191270841

View in Genome Browser
Species Human (GRCh38)
Location X:58466729-58466751
Sequence GTCACATAAAAACTAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191270840_1191270841 0 Left 1191270840 X:58466706-58466728 CCTATGGTGAAAAAGGAAATATC No data
Right 1191270841 X:58466729-58466751 GTCACATAAAAACTAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191270841 Original CRISPR GTCACATAAAAACTAGACAA AGG Intergenic
No off target data available for this crispr