ID: 1191565704

View in Genome Browser
Species Human (GRCh38)
Location X:62526016-62526038
Sequence TGGGATATCTTCACAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191565704_1191565705 -10 Left 1191565704 X:62526016-62526038 CCAGTTTTTGTGAAGATATCCCA No data
Right 1191565705 X:62526029-62526051 AGATATCCCACTTCCAACGAAGG No data
1191565704_1191565708 1 Left 1191565704 X:62526016-62526038 CCAGTTTTTGTGAAGATATCCCA No data
Right 1191565708 X:62526040-62526062 TTCCAACGAAGGCCTCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191565704 Original CRISPR TGGGATATCTTCACAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr