ID: 1191573151

View in Genome Browser
Species Human (GRCh38)
Location X:62658776-62658798
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 11, 1: 56, 2: 118, 3: 118, 4: 399}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191573151_1191573154 9 Left 1191573151 X:62658776-62658798 CCCCATTGCTTGTTTTCTCAGGT 0: 11
1: 56
2: 118
3: 118
4: 399
Right 1191573154 X:62658808-62658830 ATCAGATAGTTGTTGATATACGG No data
1191573151_1191573156 24 Left 1191573151 X:62658776-62658798 CCCCATTGCTTGTTTTCTCAGGT 0: 11
1: 56
2: 118
3: 118
4: 399
Right 1191573156 X:62658823-62658845 ATATACGGCATTATTTCTGAGGG 0: 22
1: 2094
2: 4411
3: 3044
4: 3030
1191573151_1191573155 23 Left 1191573151 X:62658776-62658798 CCCCATTGCTTGTTTTCTCAGGT 0: 11
1: 56
2: 118
3: 118
4: 399
Right 1191573155 X:62658822-62658844 GATATACGGCATTATTTCTGAGG 0: 23
1: 2128
2: 4583
3: 3790
4: 4162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191573151 Original CRISPR ACCTGAGAAAACAAGCAATG GGG (reversed) Intergenic
900808951 1:4786664-4786686 ACCTGAGCAAAGAAGCAAAAGGG - Exonic
902127556 1:14228897-14228919 ACCAGAGAAGACAAGCCAAGAGG - Intergenic
902358545 1:15927057-15927079 ACATGAGAGAACAAACATTGCGG + Intronic
903471471 1:23590641-23590663 AGCTCAGAAAGCAAGCCATGTGG - Intronic
905358104 1:37398963-37398985 ACCTGGGAAACCGAGCAAGGGGG + Intergenic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
906176416 1:43777503-43777525 ACCTGACAAAACAAGCAATGGGG + Intronic
906499971 1:46334580-46334602 ACCTGAAAAAAAAAGCAGGGGGG - Intergenic
906571065 1:46841028-46841050 GCTTGACAAAATAAGCAATGGGG - Intergenic
906575015 1:46880939-46880961 ACCTGACAAAAAAATAAATGGGG + Intergenic
906600210 1:47120276-47120298 GCTTGACAAAATAAGCAATGGGG + Intergenic
906652349 1:47521720-47521742 ACCTCCGAACACAAGCAAAGGGG - Intergenic
906834586 1:49069496-49069518 CACTGACAAAACAAGCAAGGGGG - Intronic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
907038139 1:51234964-51234986 ACCTGGGAAGACAAGTAATCAGG - Intergenic
907852586 1:58270288-58270310 ACCGAGAAAAACAAGCAATGGGG - Intronic
908503830 1:64774441-64774463 ACCTGCCAAAACAAGCGATGGGG - Intronic
908628068 1:66069633-66069655 ATCTGAGAAAGCAAGGAATACGG - Intronic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
908933474 1:69344650-69344672 ACCTGACAAAAACAGCAATGGGG - Intergenic
908939675 1:69416570-69416592 ACCTGACAAAAACAGCAATAGGG - Intergenic
909281635 1:73762570-73762592 ATCAGAGAAAACAAGATATGAGG - Intergenic
909678232 1:78261975-78261997 ACCTGAAAAAGCAAGCAATGGGG + Intergenic
910258279 1:85271693-85271715 AGCTGAGGAAACAAGCACAGAGG - Intronic
911540915 1:99157419-99157441 ACCTGACAAAAACAGCAATGGGG - Intergenic
911675337 1:100652466-100652488 ACCTGACAAAACAAGCAATGGGG + Intergenic
911822059 1:102435498-102435520 ACCAGAGAAACTAAGCAATTGGG - Intergenic
912019767 1:105093193-105093215 ACCTGATAAAACAAGCAGTAAGG + Intergenic
912034301 1:105291906-105291928 ACCTGACAAAACAAGAAATGAGG - Intergenic
912656943 1:111494872-111494894 AACTGACAAAACAAGCAGTGGGG + Intronic
913352361 1:117875606-117875628 ACCTGTGAGAGCAAGCCATGTGG + Intronic
913362538 1:117998319-117998341 ACCAACAAAAACAAGCAATGAGG - Intronic
913399065 1:118407994-118408016 CCCTGACAAAAACAGCAATGGGG + Intergenic
914720675 1:150286394-150286416 AAATGAGAAAAAAAGAAATGTGG - Intronic
914842146 1:151257204-151257226 AGCTGACAAAACAAGCAGTGAGG - Intronic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915024851 1:152818015-152818037 TCCTGACAAAATAAGAAATGGGG - Intergenic
915846657 1:159273422-159273444 ACCTGACAAAAAAAGCAATAAGG + Intergenic
916536149 1:165705135-165705157 TCCTAAGAAAACAAGCCATATGG - Intergenic
916718295 1:167462961-167462983 ATCTGAGGAGACAGGCAATGAGG - Intronic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917714080 1:177716273-177716295 ATCTGACAAAACAAGAAATGGGG + Intergenic
918327205 1:183421265-183421287 ACTGGAGAAAACAAAGAATGTGG + Intergenic
918548918 1:185717450-185717472 ATCTGAGAAAAGAAACAACGGGG - Intergenic
919154721 1:193749094-193749116 ACCTGACAAAAACAACAATGGGG - Intergenic
919235143 1:194831260-194831282 AGCTGACAAAGAAAGCAATGGGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
920032863 1:203048045-203048067 ACCTGGGAAGAAAGGCAATGGGG + Intronic
920743498 1:208603443-208603465 ACCTGAGATGCCAAGCAATATGG - Intergenic
921336293 1:214090095-214090117 AACTGAAAAAACAAGCCATGGGG - Intergenic
922695078 1:227727110-227727132 AACTGAGAAACCAAAGAATGAGG - Intergenic
923696905 1:236262344-236262366 GTGTGAGAAAGCAAGCAATGTGG - Intronic
924023619 1:239810391-239810413 CCCTGAGAAGACAAGCAGCGTGG - Intronic
924102363 1:240617861-240617883 ACCCCAGAAAAAAAGCAAGGAGG - Intergenic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
924480397 1:244426684-244426706 ATGTGAGAAAGCAAGCAAAGTGG - Intronic
924613716 1:245594433-245594455 ACCTGACAAAACAAGCAATGGGG - Intronic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
924912306 1:248527256-248527278 ACCTGACAAAACAAGAAATAGGG - Intergenic
1064510466 10:16084275-16084297 ATCTGCTAAAACAAGCAATGGGG - Intergenic
1065972204 10:30814556-30814578 ACCAGAGAAAACAAGATATTGGG + Intergenic
1066153291 10:32648092-32648114 ACCAACAAAAACAAGCAATGAGG - Intronic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067207035 10:44227223-44227245 ACTTGACAAAACAAGCAATGGGG - Intergenic
1067317915 10:45186609-45186631 ACATGAGTAAACAAGCTATTTGG - Intergenic
1067675858 10:48376114-48376136 ACCTACAAAAACAAGCAGTGGGG + Intronic
1068427635 10:56888343-56888365 ATCCGAGAAAACAAAGAATGAGG - Intergenic
1069041842 10:63704008-63704030 ACCTGAGAAACCATCCAAGGTGG + Intergenic
1069443611 10:68452543-68452565 CCCTGGAAAAAGAAGCAATGTGG + Intronic
1070413541 10:76167518-76167540 ATTGGACAAAACAAGCAATGGGG - Intronic
1071198393 10:83188585-83188607 ACTGCAGAAAACAAGAAATGTGG - Intergenic
1072373413 10:94789609-94789631 ACCTGACAAAAAAAGAAATAGGG - Intronic
1072408197 10:95174516-95174538 ACCTGACAAAACAAGCAATGGGG - Intergenic
1072488195 10:95876169-95876191 ACCTAAGAAAACTGACAATGTGG - Exonic
1072961401 10:99932701-99932723 ACCAGAGGAAACAAGCAGTGTGG + Intronic
1072964927 10:99963660-99963682 ACCAGAGGAAACAAGCAGTGTGG - Intronic
1073927127 10:108530184-108530206 ACCTGACAAAACAAGCAATGGGG + Intergenic
1074013793 10:109511644-109511666 AGCTGACAAAACAAGCATTAGGG - Intergenic
1074594837 10:114852647-114852669 AGCTGAGGAAACAAGTTATGAGG - Intronic
1074612160 10:115032334-115032356 AGTTGACAAAATAAGCAATGAGG - Intergenic
1074773430 10:116748444-116748466 CCCTGAGAAGAGTAGCAATGAGG - Intergenic
1075332968 10:121587133-121587155 ACTGATGAAAACAAGCAATGGGG + Intronic
1075502964 10:122994472-122994494 ACAGAAGAAAACAAGCAATCTGG - Exonic
1075814178 10:125251960-125251982 ACCTGCCAGAACAAGAAATGGGG - Intergenic
1078120095 11:8498808-8498830 ACCTGACACAAACAGCAATGGGG + Intronic
1078278074 11:9870580-9870602 ACCTGACAGAACAAGCAATGGGG + Intronic
1078813628 11:14797128-14797150 ACCTGACACAACAAGCAATGGGG - Intronic
1078927935 11:15891153-15891175 AACTGAGAACAAAAGCAAAGAGG + Intergenic
1079735209 11:23988830-23988852 AGATGAGAAAACCACCAATGAGG - Intergenic
1080218481 11:29873030-29873052 ATCTTTGACAACAAGCAATGGGG - Intergenic
1081007752 11:37768466-37768488 ACTTGAGAAAAAAAGCATTTTGG - Intergenic
1081035027 11:38133474-38133496 ACCTGACAAAATAAGGAATGGGG + Intergenic
1081053077 11:38370675-38370697 ACCTTAGAAAACTAGAAAAGAGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081402045 11:42654699-42654721 ACCTGACAAAACAAGCAATGGGG - Intergenic
1082680927 11:56169041-56169063 ACCAACAAAAACAAGCAATGAGG + Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082871698 11:57948817-57948839 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1084918279 11:72447993-72448015 GCTGCAGAAAACAAGCAATGTGG - Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1087111778 11:94477754-94477776 GTCTGAGAGAAAAAGCAATGCGG + Intronic
1087278820 11:96187268-96187290 GTCTGAGAAAACCAGCAATCTGG - Intronic
1087573686 11:99963423-99963445 ACCTGACAAAAAAAGAAATGGGG - Intronic
1087663029 11:101009710-101009732 TCCTCACAAAACAAGCAATTTGG - Intergenic
1087668251 11:101075196-101075218 ATCTGACCAAAAAAGCAATGGGG + Intronic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088052118 11:105529709-105529731 AGCTGGCAAAACAAGCAATGAGG + Intergenic
1088061470 11:105656247-105656269 ACCTGACAAAATGAGCAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088467763 11:110159761-110159783 ACCTGAGGAAACAGACACTGGGG + Intronic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1089392175 11:118109644-118109666 AGAAAAGAAAACAAGCAATGTGG + Intronic
1090741298 11:129663320-129663342 ACCTGAAAAAACAAGCGATGGGG + Intergenic
1090979671 11:131708139-131708161 AATTAAGAAAACAATCAATGTGG + Intronic
1091903442 12:4164366-4164388 ACCTGAGAATGGAAGCAAGGAGG - Intergenic
1092286477 12:7131641-7131663 ACCTGGGAAGACAAGCAGGGTGG + Intronic
1093498297 12:19781933-19781955 ACCAACAAAAACAAGCAATGAGG + Intergenic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1093636548 12:21477968-21477990 ATCTGAAAAAACAAACAAAGTGG + Exonic
1093756398 12:22857812-22857834 ACATGAGAAAACATGCAACATGG + Intergenic
1093832930 12:23787214-23787236 AACTGATAAAACAAGCATTTAGG + Intronic
1093855917 12:24102030-24102052 CCCTGACATAACAAACAATGAGG + Intergenic
1095303590 12:40614794-40614816 ACCTGTGAAGCCAAGAAATGAGG - Intergenic
1095620665 12:44249718-44249740 CCATGTAAAAACAAGCAATGGGG + Intronic
1095745394 12:45652812-45652834 AGCTGAGAAAAAAAGAAAAGAGG + Intergenic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1095903317 12:47351119-47351141 AGCTGAGAAAAGAGCCAATGTGG - Intergenic
1095914648 12:47465048-47465070 ACCTGACAAAACAAGCAATGGGG - Intergenic
1096036042 12:48471607-48471629 ACCAAGAAAAACAAGCAATGGGG - Intergenic
1096403858 12:51328639-51328661 CCCTGAGGAAACAAGAAAGGAGG - Intronic
1096736614 12:53660463-53660485 AACTCAGAAAATAAGCAGTGGGG + Intronic
1097391808 12:59024348-59024370 ACCAGAGAGAACAAGGAATGAGG - Intergenic
1098572938 12:72009541-72009563 AGCTGAGATTACAATCAATGAGG - Intronic
1099339069 12:81404041-81404063 TTCTGAGAAAACAAGAATTGAGG + Intronic
1100115700 12:91301177-91301199 CCTGAAGAAAACAAGCAATGGGG + Intergenic
1100138062 12:91579397-91579419 TTCTGAGAAAATAAGCACTGAGG - Intergenic
1100750427 12:97692575-97692597 ACCTGACAAAACAAGAAATGGGG - Intergenic
1101069398 12:101058127-101058149 ACCTGACAAAAACAGCAATGGGG - Intronic
1101263576 12:103060700-103060722 ACCAACAAAAACAAGCAATGGGG + Intergenic
1101467721 12:104964869-104964891 AACTAAGAAGACAAGAAATGAGG + Intergenic
1102107420 12:110337288-110337310 ACCTCACCAAACAAGCCATGGGG - Intronic
1102832354 12:116015273-116015295 ACCTGAAAAAAAAGGCAATTTGG + Exonic
1103254155 12:119526139-119526161 AGGTGACAAAACAAGCAATGGGG + Intronic
1107032952 13:35871729-35871751 ACCTCATAAACCAAGAAATGTGG + Intronic
1107201227 13:37720422-37720444 ACATGAGAAACCGAGCAATGAGG + Intronic
1107232665 13:38129398-38129420 AGTTGACAAAACAAGCAATGAGG - Intergenic
1107397924 13:40037463-40037485 ATTTGACAAAACAAGCAATGAGG - Intergenic
1107615698 13:42164770-42164792 AGCTGAGAAAATAAGCATGGGGG + Intronic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1109388093 13:61658672-61658694 ACCTCGCAAAACAAGCAATGGGG - Intergenic
1110071711 13:71186002-71186024 ACCTGACAAAACAAGAAATGGGG + Intergenic
1110128932 13:71982219-71982241 ACCAACAAAAACAAGCAATGGGG - Intergenic
1110977681 13:81861438-81861460 ACCGATAAAAACAAGCAATGAGG + Intergenic
1111402661 13:87761421-87761443 ACCTGAGAGAACTCTCAATGGGG - Intergenic
1111434855 13:88193169-88193191 ACCTGACAAAACAAGAAATGGGG - Intergenic
1111488290 13:88934031-88934053 AAGTGAGAAAAAAAGAAATGTGG + Intergenic
1111786624 13:92795260-92795282 ACCTACAAAAACAAGAAATGGGG + Intronic
1111967517 13:94875953-94875975 ACCTGACAGAACAAGAAATGGGG + Intergenic
1113094655 13:106650885-106650907 ACCTCAGAGAACAGGCAAGGAGG + Intergenic
1113488551 13:110674441-110674463 ACCTGACAAAAAAAGAAATGGGG + Intronic
1114191363 14:20441711-20441733 ACCTGAAAGGAGAAGCAATGAGG - Intergenic
1114368453 14:22056886-22056908 GCCAAGGAAAACAAGCAATGGGG + Intergenic
1114781860 14:25547159-25547181 CCCTTAGAAAGCAAGCAAAGAGG - Intergenic
1115092311 14:29592753-29592775 ACCTAAGAGAACAAGTAACGTGG + Intronic
1115915325 14:38306027-38306049 AGCTGACAGAGCAAGCAATGGGG + Intergenic
1115947251 14:38676024-38676046 ACCTGACAAAACAAGAAATGGGG + Intergenic
1116121774 14:40729970-40729992 GTATAAGAAAACAAGCAATGGGG - Intergenic
1116354050 14:43905107-43905129 ACCTGACAAAACAAGCACTGGGG - Intergenic
1116648858 14:47564710-47564732 GGGAGAGAAAACAAGCAATGTGG - Intronic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1117030334 14:51662524-51662546 ACCTGACAAAACAAGCAATGGGG + Intronic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1117640249 14:57790860-57790882 ACCTGACAAAAAATGCAATGGGG + Intronic
1117655888 14:57956166-57956188 ACCTAACAAAACAAGAAATGGGG + Intronic
1117893069 14:60447919-60447941 ACCTGACAAAAACAGCAACGGGG + Intronic
1120043177 14:79776693-79776715 AACTGAGAAGACAAAGAATGTGG + Intronic
1120526489 14:85582937-85582959 AGCTGTGAAATCAAACAATGAGG - Intronic
1120563397 14:86024734-86024756 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1121513039 14:94527285-94527307 AGCTGAAAAAACAAGCAACAGGG + Intergenic
1121612250 14:95289650-95289672 ACCAGGGAAAAGAAGCAATCAGG + Intronic
1122833111 14:104413293-104413315 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1123157629 14:106244170-106244192 ACCTGACAAAACAAGAAATGGGG - Intergenic
1123179406 14:106454272-106454294 GGCTGACAAAACAAGCAATGGGG - Intergenic
1123221149 14:106857128-106857150 ACCTGACAAAAACAGCAATGGGG - Intergenic
1202891655 14_KI270722v1_random:164883-164905 ACCTGAAATTACAAGAAATGAGG + Intergenic
1124683921 15:31762321-31762343 GACAGAGAAAAAAAGCAATGAGG - Intronic
1125238370 15:37543574-37543596 GCCAGCAAAAACAAGCAATGAGG + Intergenic
1125274170 15:37973041-37973063 AGTTGACAAAACAGGCAATGGGG - Intergenic
1125644367 15:41259657-41259679 ATCTGAGGAATCAAGTAATGTGG - Intronic
1126233851 15:46358849-46358871 AAATGGAAAAACAAGCAATGGGG + Intergenic
1126278039 15:46907786-46907808 ACCTGGAAAAACAAGCAATGAGG - Intergenic
1127136297 15:55927245-55927267 ACATGAGAAAAGAAGGCATGGGG + Intronic
1127185641 15:56477084-56477106 ACCTGAAAAAAAAAGAAATGGGG - Intergenic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1128005023 15:64230640-64230662 ACCTGAGTACTCAAGTAATGGGG - Intronic
1130779570 15:87021219-87021241 ACCCGACAAATCCAGCAATGGGG + Intronic
1130832676 15:87617276-87617298 ATCTGAGAAACCCAGGAATGTGG + Intergenic
1131520305 15:93109504-93109526 ACCAGATAACACAAGGAATGCGG - Intergenic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1134424169 16:14123545-14123567 ACCTATACAAACAAGCAATGGGG - Intronic
1135210003 16:20517216-20517238 ATCTCAGAAAAAAAACAATGAGG + Intergenic
1135376179 16:21949383-21949405 ACCTGTGAAAATAAGCTATCAGG + Intergenic
1136600118 16:31280002-31280024 ACCTGAAAAAACAAGAAATGGGG - Intronic
1137652258 16:50130571-50130593 AACAGAGAAACCAAGGAATGAGG - Intergenic
1139131880 16:64156615-64156637 CCCTGACAAAACAAGACATGGGG + Intergenic
1140470746 16:75212981-75213003 ACCTGTTAATACAAACAATGCGG - Intergenic
1140755344 16:78061521-78061543 AGCTGAGAAAAAAAGCACAGAGG + Intronic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1143348243 17:6266308-6266330 AGATGAGAAAACAGGCAAAGAGG - Intergenic
1144383084 17:14722317-14722339 AGCTGACAAAACAAGTAATGGGG + Intergenic
1145293021 17:21564788-21564810 ACCTTAGAGAACAAGAATTGTGG + Intronic
1145386944 17:22421138-22421160 ACCTTAGAGAACAAGAATTGTGG - Intergenic
1146506491 17:33410120-33410142 ACCTGAGACAGGTAGCAATGAGG + Intronic
1146622477 17:34409783-34409805 AGCTGACAAAAACAGCAATGGGG + Intergenic
1146743698 17:35309066-35309088 ACCTGATAAAACAAGCAATGGGG + Intergenic
1146765537 17:35517774-35517796 AACTGACAAAACAAACAATGGGG + Intronic
1149235447 17:54584970-54584992 AGCTGAGAAAACAAGCAATAGGG + Intergenic
1150810892 17:68356296-68356318 AGCAGAGAAAGCCAGCAATGGGG + Intronic
1150894125 17:69189786-69189808 GCCAGTGAAAACAAACAATGGGG - Intronic
1151334908 17:73434094-73434116 GCCTGAGAATCCAAGCAGTGTGG - Intronic
1153406319 18:4744357-4744379 AACTGAGAAACCAAGTAAAGTGG + Intergenic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153701921 18:7702943-7702965 ACCTGACAAAAACAGCAATGGGG - Intronic
1154288144 18:13079901-13079923 ACCTGACAAAAAAAGAAATGGGG - Intronic
1154288740 18:13085659-13085681 ACTTGACAAAACAAGAAATGGGG - Intronic
1155735729 18:29220161-29220183 ACCTGACAAAAAAAGAAATGGGG + Intergenic
1155769104 18:29674079-29674101 GGATGAGAAAACAAGCAATGTGG + Intergenic
1155856887 18:30845530-30845552 ACCTGACAAATCAAGCAAGGGGG - Intergenic
1155861636 18:30908981-30909003 AGTTGACAAAAAAAGCAATGGGG + Intergenic
1156402315 18:36750749-36750771 AGCTGACAAAACAAGCAATGGGG - Intronic
1156551015 18:38016805-38016827 ACCTGACAAAACAAGCAATGGGG - Intergenic
1157003526 18:43554881-43554903 ATCTACAAAAACAAGCAATGAGG - Intergenic
1157396890 18:47349492-47349514 ACCTGGAAAAACAAGCAATGGGG - Intergenic
1158078347 18:53559017-53559039 AGTTGATAAAATAAGCAATGAGG + Intergenic
1158095776 18:53768953-53768975 ACCTGACAAAACAAGCAATGGGG + Intergenic
1158098430 18:53802143-53802165 ACCTGACAAAAACAGCAATCAGG - Intergenic
1160432940 18:78824747-78824769 AACTGAGAACAGAAGCAATTGGG + Intergenic
1161186568 19:2925575-2925597 AACTTTGAAAACATGCAATGTGG + Intergenic
1162158109 19:8693716-8693738 ACCACAGCAAACAAGAAATGGGG - Intergenic
1164266029 19:23618377-23618399 ACCTGACAAAAAAAGAAATGGGG + Intronic
1164866531 19:31608901-31608923 GCCTGAGAAAGAAAGCAATGTGG + Intergenic
1166433352 19:42745212-42745234 ACTTGAGAAAACAAGCAATGGGG - Intronic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1167964444 19:53132189-53132211 ACCTGAGACAGGAAGGAATGAGG - Intronic
1168528967 19:57111637-57111659 CCCTGTGAAGGCAAGCAATGGGG - Intergenic
1168602752 19:57732147-57732169 ACCTGAAAAAACAAACAATGGGG + Intronic
925053793 2:839450-839472 ACCTGACAAAAACAGCAATGGGG + Intergenic
925133044 2:1507149-1507171 ACCTGACAAAAACAACAATGGGG - Intronic
925419462 2:3700263-3700285 TCTTAAAAAAACAAGCAATGGGG - Intronic
925647356 2:6050024-6050046 AGCTGACAAAAAAAGCAATGGGG + Intergenic
926494604 2:13569586-13569608 AAATGAAAAAACAAGTAATGTGG - Intergenic
927015501 2:18955949-18955971 ATCTGACCAAAAAAGCAATGGGG + Intergenic
928486898 2:31741427-31741449 ACCTGACAAAACAAGAAATGGGG - Intergenic
928488003 2:31752185-31752207 ACCTGACAAAACAAGAAATGGGG + Intergenic
929062467 2:37937169-37937191 ACCTGACAAAAACAGCAATAGGG - Intronic
929358570 2:41055578-41055600 ACCTGACAAAAAAAGAAATAGGG - Intergenic
930127900 2:47817412-47817434 CCCTGAGAAACTAAGCAATAAGG + Intronic
930254126 2:49069336-49069358 GTCTGAGATAACAAGCCATGAGG - Intronic
930270173 2:49247045-49247067 ACCTGACAAAATAAAAAATGGGG + Intergenic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930598693 2:53418906-53418928 ATCTGACAAAACAAGCAATGGGG - Intergenic
930933354 2:56916837-56916859 ACCTGACAAAACAAGCAATGGGG + Intergenic
931015288 2:57971384-57971406 AACTGTTTAAACAAGCAATGTGG - Intronic
931215303 2:60236594-60236616 ACCTGCAAAAACAAGATATGGGG - Intergenic
931318165 2:61151713-61151735 ACCTGAGAGAAAAGGCAAGGAGG + Intronic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932891513 2:75600976-75600998 ACCTGAGAAGAGAAGCCTTGAGG - Intergenic
933856604 2:86420151-86420173 ATGTGAGAGAACAAGCCATGTGG - Intergenic
933944253 2:87271252-87271274 ACCTGACAAAACAAGAAATGGGG - Intergenic
934955485 2:98614300-98614322 TCCTGAGATAACAAGGTATGAGG + Intronic
935020706 2:99228283-99228305 ACCTGACAAAACAAGAAATGGGG + Intronic
935036083 2:99375331-99375353 ACCTGAGTGAACTAGCAATATGG + Intronic
935651667 2:105387345-105387367 ACCTGAGATTAGATGCAATGAGG + Intronic
936335963 2:111590327-111590349 ACCTGACAAAACAAGAAATGGGG + Intergenic
936947521 2:117943911-117943933 ACTAGAGAAAATAAGTAATGAGG - Intronic
937520936 2:122711855-122711877 ACTTGCTTAAACAAGCAATGTGG - Intergenic
938670209 2:133579365-133579387 AAGTGAGAAATCAAGCAATCAGG + Intergenic
939941384 2:148355544-148355566 ACTGGCAAAAACAAGCAATGGGG - Intronic
940603242 2:155887080-155887102 ACCTGAGAAAGAAATCAATAAGG + Intergenic
941009391 2:160282270-160282292 ACCAGAGAAAACAAGTATCGGGG - Intronic
941278704 2:163523166-163523188 ACTGGAAAAAAGAAGCAATGGGG - Intergenic
941622913 2:167798549-167798571 GCCAGCAAAAACAAGCAATGGGG - Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
941847384 2:170147106-170147128 TCTTGAAAAACCAAGCAATGTGG + Intergenic
942362921 2:175191605-175191627 ACCTGACAAAATAAGAAATGGGG + Intergenic
942755056 2:179330677-179330699 CTTTGACAAAACAAGCAATGAGG + Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943232406 2:185271614-185271636 ACCTGACAAAACAAGCAATGGGG - Intergenic
943351709 2:186804576-186804598 AGGAGAGAAAACAAGCAATTTGG - Intergenic
943455989 2:188107716-188107738 AATTGACAAAGCAAGCAATGGGG + Intergenic
943555827 2:189402658-189402680 ACCTGACAAAAGCAACAATGGGG - Intergenic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
946019178 2:216628557-216628579 AGTTGAGAAAATAAGCAATGGGG - Intergenic
946037184 2:216753550-216753572 ACTTTTGAAAACAAGCAGTGTGG + Intergenic
946631935 2:221678703-221678725 ACCTCAGAAAACATACAATCAGG - Intergenic
946783440 2:223217587-223217609 TCCTGACAAAGCAAGCTATGGGG - Intergenic
947565888 2:231192762-231192784 AGCTGAGACCACAAGCAAAGAGG - Intergenic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947978649 2:234388975-234388997 ACCTGACAAAACAAGCAACGGGG + Intergenic
948240011 2:236422927-236422949 ACCTGAAAAAACAAGAAATGGGG + Intronic
948942313 2:241202723-241202745 CCCTGAGAAAACAGCCACTGTGG + Intronic
1169678193 20:8178898-8178920 AGTCGACAAAACAAGCAATGGGG - Intronic
1170228933 20:14023665-14023687 ACCTGACTAAACAAGCAATGGGG - Intronic
1170252743 20:14303350-14303372 ACCTCAGAAAACAAGCTCTCTGG - Intronic
1171019932 20:21575848-21575870 AGCTAAGAAAACCATCAATGTGG - Intergenic
1171575083 20:26302347-26302369 ACCTGAGAAAACAAGCAACGGGG - Intergenic
1173055635 20:39609801-39609823 ACCTGACAAAACACGCAATGGGG + Intergenic
1174373249 20:50108439-50108461 ACCTCAGAGAATAAGAAATGGGG + Intronic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1177315096 21:19449622-19449644 AAATAAAAAAACAAGCAATGGGG + Intergenic
1177388575 21:20438090-20438112 AACTGACAAAAAAAGCTATGGGG + Intergenic
1177463795 21:21447276-21447298 ACCTGACAAAACAAGCAATGGGG + Intronic
1177951361 21:27542079-27542101 ATCTGACAAAACAAGTAATGGGG + Intergenic
1178033950 21:28559851-28559873 CCCAAAGAAAACAAGCAATGGGG + Intergenic
1178487481 21:33027980-33028002 ATCTGCGAACCCAAGCAATGGGG + Exonic
1179121775 21:38553559-38553581 AGTAGACAAAACAAGCAATGTGG + Intronic
1180524271 22:16239907-16239929 ACCTGCAAAAACAAGCAATGGGG + Intergenic
1180880896 22:19202803-19202825 TCCTGAGAAAACAAACTATCAGG + Intronic
1182192658 22:28478894-28478916 TCCTGAGAAGACAATAAATGAGG - Intronic
1182761742 22:32727966-32727988 ACCTGACCAAACAAGCAATGGGG + Intronic
1183227901 22:36563000-36563022 AACTGTGAAAACAAAAAATGGGG - Intergenic
949432773 3:3995601-3995623 ACCTGACAAAACAAGCAATGAGG - Intronic
949435522 3:4025041-4025063 AGCTGAGAAACCAAAGAATGAGG - Intronic
951070411 3:18321753-18321775 AGCTGATAAAACAAGCAATGAGG - Intronic
951197670 3:19842169-19842191 ACCTGACAAAACAAGTAATGGGG - Intergenic
951233458 3:20206949-20206971 ACCAACAAAAACAAGCAATGAGG - Intergenic
951896790 3:27617075-27617097 AGCTCAGAAACCAAGCACTGGGG + Intergenic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952522235 3:34173086-34173108 ACCTGACAAAACAAGCAATGGGG - Intergenic
952574001 3:34752511-34752533 ACCAACAAAAACAAGCAATGGGG + Intergenic
952704365 3:36362269-36362291 AGCTGAGAGACCAAGAAATGGGG + Intergenic
952998994 3:38913758-38913780 AGCTGACAAAACAAGCAATGAGG - Intronic
953116620 3:39998903-39998925 ACCTGACAAAACAAGCAATGGGG + Intronic
953721450 3:45358896-45358918 AGTTGACAAAACAAGCAATGGGG - Intergenic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
955637684 3:61047851-61047873 ACATGAAAAAACAAGCAATGGGG + Intronic
955854683 3:63260446-63260468 ACCTGACAAAACAAGAAATGGGG + Intronic
956940474 3:74155094-74155116 ACATGAGAAAAAAAGCAAAGTGG + Intergenic
957241403 3:77665385-77665407 ACTTACAAAAACAAGCAATGGGG - Intergenic
957688513 3:83536947-83536969 ACCTGAAAAAAAAAGAAATGGGG + Intergenic
957721855 3:84012473-84012495 ACCTGACAAAATAAGAAATGGGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
957951485 3:87132841-87132863 AGTCAAGAAAACAAGCAATGGGG - Intergenic
958270552 3:91493769-91493791 ACTTGAGAAACAAAGCAGTGTGG + Intergenic
958541816 3:95486962-95486984 ACCTGAGATTACTAGAAATGGGG - Intergenic
958570530 3:95876438-95876460 CCTTTAAAAAACAAGCAATGGGG + Intergenic
958673584 3:97236028-97236050 ACCTGAGAAAAAAAGTTAAGAGG - Intronic
959002464 3:100980573-100980595 ACCTGAGAAGACACGCAAGTGGG + Intronic
959007015 3:101030981-101031003 CCTGGTGAAAACAAGCAATGGGG + Intergenic
959119876 3:102220684-102220706 ACCTGACAAAACAAGCAACGGGG - Intronic
959175618 3:102905632-102905654 ACCTGAGAAAAGTAGGAGTGAGG - Intergenic
959203415 3:103276867-103276889 ACTGAACAAAACAAGCAATGAGG - Intergenic
959494804 3:107037830-107037852 ACCTGATAAAACAAGTAATGGGG + Intergenic
959775240 3:110151708-110151730 ACATGACAAAACAACCAACGAGG - Intergenic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
959947662 3:112144013-112144035 AGTTGACAATACAAGCAATGGGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
960450762 3:117804774-117804796 ACCTGAGAAATCAACCAAGTAGG + Intergenic
961009551 3:123426714-123426736 CCCTGAGAAAGGAAGCTATGTGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
962091883 3:132252866-132252888 ACCTTAGAAAACCAGCAGTTTGG - Intronic
963307285 3:143667207-143667229 ACCTGACCAAAAAAGAAATGGGG + Intronic
963381859 3:144540676-144540698 AATTGACAAAATAAGCAATGGGG + Intergenic
963387507 3:144615873-144615895 ACCTCAAAAAACAAGCAATGGGG - Intergenic
963460975 3:145614771-145614793 ACCGACCAAAACAAGCAATGGGG - Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964780063 3:160327553-160327575 ACCTGACAAAACAAGCAATGAGG + Intronic
965808563 3:172568198-172568220 AGCTGACAAAACAAGCAATGGGG - Intergenic
966291612 3:178366007-178366029 ACCTGACAAAACAAGAAATGGGG + Intergenic
966362075 3:179140740-179140762 AGTTGCAAAAACAAGCAATGGGG + Intergenic
967431740 3:189393279-189393301 GCCTCAGAAAGCCAGCAATGAGG + Intergenic
970012652 4:11476846-11476868 AGCTGACAAAACAAACAATGAGG + Intergenic
970210003 4:13699631-13699653 AGCTGACAAAATAAGCAATGGGG - Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971693936 4:29873474-29873496 ACCTGACAAAAGAAGAAATGGGG - Intergenic
971815243 4:31478422-31478444 GGCTGACAAAAAAAGCAATGGGG - Intergenic
971817571 4:31508169-31508191 ACTTAAGAAAAAAATCAATGAGG - Intergenic
971863884 4:32143716-32143738 ACCTGAAAAAACAAGCAATGAGG - Intergenic
972219751 4:36940465-36940487 ACCTGACAAAACAAGCAATGAGG + Intergenic
972220869 4:36952574-36952596 ACTGAAAAAAACAAGCAATGGGG - Intergenic
973098581 4:46232647-46232669 GCCTGCAAAAACAAGCAATGGGG - Intergenic
973328429 4:48887602-48887624 ACCTGAAAAAACAAGAAATGGGG - Intronic
973683410 4:53344825-53344847 ACCTGAGAAAACAAGCAACGGGG + Intronic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
974110463 4:57519786-57519808 ACCTGGCAAAAAAAGAAATGGGG + Intergenic
974531705 4:63116409-63116431 ACCTGACAAAGCAAGGCATGGGG - Intergenic
974539414 4:63214767-63214789 ATATGACAAAACAAGCAATGGGG - Intergenic
974562879 4:63544392-63544414 AGTTGAAAAAATAAGCAATGAGG + Intergenic
974649841 4:64741135-64741157 ACCTGAGAAAAACAACAATGGGG + Intergenic
975007150 4:69304215-69304237 ACCATACAAAACAAGAAATGGGG + Intronic
975483734 4:74911458-74911480 ACCTGACAAAAAAAACAATGGGG - Intergenic
975513181 4:75216271-75216293 ACCTGACAAAACAAGCAATAGGG - Intergenic
976363593 4:84208471-84208493 CCCGGCAAAAACAAGCAATGGGG + Intergenic
976524486 4:86071657-86071679 ACCTGAGAAAAACAACAATGGGG - Intronic
976912941 4:90330586-90330608 AGCTGAGAAAAAAAGAAGTGAGG + Intronic
977536474 4:98261072-98261094 CCCGGAGAAAACAGGGAATGGGG - Intergenic
978117087 4:105032529-105032551 ACCTGACAAAACAAGAAATGGGG + Intergenic
978544283 4:109853851-109853873 ACCTGACAAAACAAGCAATGGGG - Intronic
978657291 4:111079425-111079447 ACCTGACAAAACAAGCAATAGGG + Intergenic
978744632 4:112178470-112178492 AGCAGACAAAACAAGCAATGGGG - Intronic
979781712 4:124659436-124659458 ATTTAAGAAAACAAGAAATGTGG - Intergenic
979985822 4:127313130-127313152 ACCTGACACAGCAAGCAATGGGG + Intergenic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980198612 4:129624954-129624976 ACCTGACAAAACAAGAAATGGGG - Intergenic
980594993 4:134942719-134942741 ACTTGAGAAACAGAGCAATGGGG + Intergenic
980688036 4:136255759-136255781 ACCTGACAAAACAAACAATGGGG + Intergenic
980867414 4:138569636-138569658 ACCTGAAAAACCAAGAAATGGGG + Intergenic
981302280 4:143201256-143201278 AGCTGTCAAAACAAGCAATGGGG + Intronic
981757462 4:148155988-148156010 CCCGAGGAAAACAAGCAATGGGG + Intronic
982336787 4:154248812-154248834 GCCAGCAAAAACAAGCAATGAGG + Intronic
982647472 4:158042401-158042423 ATCACCGAAAACAAGCAATGGGG + Intergenic
982686064 4:158490358-158490380 ACCTACAAAAACAAGCAATGGGG - Intronic
982792614 4:159610681-159610703 ACCTGAAAAAACAAGAAATGGGG - Intergenic
982810522 4:159820266-159820288 ACCTGCCAAAACAAGCAATGGGG + Intergenic
983018857 4:162649323-162649345 AGCTGACAAAACAAACAATGGGG - Intergenic
983030734 4:162798616-162798638 ACCTACAAAAACAAGCAATGGGG - Intergenic
983371595 4:166866157-166866179 CCCTACAAAAACAAGCAATGGGG + Intronic
983441557 4:167793061-167793083 AGTTGACAAAACAAGCAATGGGG - Intergenic
983958454 4:173724068-173724090 ACCTGACAAAACAAGCAACGGGG - Intergenic
984071476 4:175119195-175119217 ATCTAAGAAAACAACCATTGTGG - Intergenic
984275510 4:177605369-177605391 ACCTGGGAAAAAAAGCCATCAGG - Intergenic
984570311 4:181383952-181383974 AGGTGAGAAAACAAACCATGAGG - Intergenic
985159750 4:187032245-187032267 ACCTGACAAAAACAGAAATGGGG - Intergenic
985233329 4:187845736-187845758 ACCTGACAAAAACAACAATGGGG + Intergenic
986172003 5:5322255-5322277 ACCTGAAAAAACAAGCAACGAGG - Intergenic
986802466 5:11276455-11276477 CACTTAGAAATCAAGCAATGAGG - Intronic
987019741 5:13857738-13857760 ACCTGACAAAACAAGCAATAGGG + Intronic
987229202 5:15875139-15875161 ACCTGATAAAACAAGCAGTGGGG + Intronic
987260848 5:16201295-16201317 ATTTGACAAAACAAGCAATGGGG + Intergenic
987464753 5:18258648-18258670 ATCTGAGAAAAAAAGCAGTGGGG + Intergenic
987560620 5:19515111-19515133 ACTTGACAAAACAATAAATGGGG - Intronic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
987975832 5:25013903-25013925 ATCTGACAAAAACAGCAATGGGG + Intergenic
988063926 5:26210176-26210198 AGTTGACAAAATAAGCAATGGGG + Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988675558 5:33429343-33429365 ACCTGAAAAAACAAGCAATGAGG - Intergenic
988855066 5:35220265-35220287 ACCCGAGGTAAGAAGCAATGAGG - Intronic
989140931 5:38200619-38200641 AACTGATTAAACAAGCATTGAGG - Intergenic
989656968 5:43754979-43755001 ACTTGACAAAATCAGCAATGGGG - Intergenic
989816532 5:45744336-45744358 ACCTGAGAAAAACAACAATGGGG - Intergenic
989848055 5:46171277-46171299 ACCTGACAAAACAAGAAATGGGG + Intergenic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990111917 5:52336883-52336905 ACCTGACCAAAAAAACAATGGGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
990175681 5:53105451-53105473 ACCTACAAAAACAAGCAATGGGG + Intronic
990234900 5:53756625-53756647 ACCCAAAAAAACAAGAAATGGGG + Intergenic
990610438 5:57451572-57451594 GCCAGAGAAAACCAGCACTGGGG + Intergenic
991684946 5:69173154-69173176 AGCTGAGAAACCAAGGAATTAGG + Intronic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992853870 5:80840281-80840303 ACCTGACAAAACAAGCAATGGGG + Intronic
992854077 5:80842170-80842192 ACCTGACAAAACAAGCAATGGGG - Intronic
993023226 5:82617055-82617077 ACCTGACAAAACAAGAAATGGGG + Intergenic
993081080 5:83301840-83301862 ACCTGAAAAAACAAGCAATGGGG - Intronic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
994259809 5:97643971-97643993 ACCAATAAAAACAAGCAATGGGG + Intergenic
994344252 5:98665584-98665606 ACCTGACAGAAACAGCAATGGGG + Intergenic
994479053 5:100310019-100310041 ACCTAACAAAACAATCAATGGGG + Intergenic
994672250 5:102776600-102776622 ACCTGACAAAAACAACAATGGGG - Intronic
995163886 5:109014347-109014369 ACCTGACAAAAACAACAATGGGG - Intronic
995586142 5:113650673-113650695 ACCTGACAAAAAAAGAAATGGGG + Intergenic
995631001 5:114132395-114132417 CCCAGCAAAAACAAGCAATGGGG - Intergenic
996144130 5:119952628-119952650 ATATGTTAAAACAAGCAATGGGG + Intergenic
996337196 5:122397734-122397756 ATCTGTGAAAACATGGAATGTGG + Intronic
996426201 5:123315789-123315811 ACCTGACAAAATAAGTCATGGGG - Intergenic
996687903 5:126304491-126304513 ACTTGACAAAACAACCAACGGGG + Intergenic
996902513 5:128558797-128558819 ACCTGAAAAAACAAGCAATAAGG + Intronic
996909920 5:128644342-128644364 ATAAGAGAAAAAAAGCAATGAGG - Intronic
997188485 5:131905756-131905778 ATCTACCAAAACAAGCAATGGGG + Intronic
999607299 5:153330054-153330076 ACCTGAGAAAAACAACAACGGGG + Intergenic
1000521934 5:162306029-162306051 ACCTGGCAAAAACAGCAATGGGG + Intergenic
1000753604 5:165129091-165129113 ATATGAGAAAAAAATCAATGTGG - Intergenic
1001213739 5:169835553-169835575 ACCATAGAAAACAAGCATTTTGG - Intronic
1001721652 5:173861770-173861792 AGATCAGAAAACAAGCAAGGTGG - Intergenic
1002203904 5:177549509-177549531 ACATGAGAAAACAAACCAAGAGG + Intronic
1002454096 5:179336481-179336503 ATCAGAGAAACCAAGCACTGTGG + Intronic
1003625660 6:7738982-7739004 ATCCAAGAAAACAAGCCATGAGG - Intronic
1004206720 6:13598346-13598368 ACCTGAGAGAACATGAAAGGAGG + Intronic
1004760542 6:18661252-18661274 ACCTACAAAAACAAGCAATGAGG + Intergenic
1004856877 6:19760074-19760096 ACATGAGCAGACAAGCCATGAGG + Intergenic
1005013588 6:21358043-21358065 ACCTGAGAAAACAAGATATCGGG - Intergenic
1005186781 6:23171486-23171508 AGGTGAGAAAAGAAACAATGAGG + Intergenic
1005426878 6:25712088-25712110 ACCTTAGAAATCAATCAATCTGG - Intergenic
1005530859 6:26704320-26704342 ACATGAGAAAACAGGAACTGGGG - Intergenic
1005539937 6:26797326-26797348 ACATGAGAAAACAGGAACTGGGG + Intergenic
1006712620 6:36088003-36088025 ACCTGACAAAACGAGCAATGGGG + Intronic
1007514104 6:42397604-42397626 ACCTGAAAAGACAAACAACGAGG - Intronic
1008029793 6:46681692-46681714 ACCCGTGATAACAAGCAATTAGG - Intergenic
1008175731 6:48266031-48266053 ACCTGAAAAAGCAAGCAATGGGG - Intergenic
1008462751 6:51794785-51794807 ACCTCAAAAAACAAGCAGTGGGG - Intronic
1008984593 6:57527575-57527597 ACTTGAGAAACAAAGCAGTGTGG - Intronic
1009172640 6:60420463-60420485 ACTTGAGAAACAAAGCAGTGTGG - Intergenic
1009709192 6:67295932-67295954 CCTTGACACAACAAGCAATGGGG - Intergenic
1009915635 6:69992162-69992184 GCTTACGAAAACAAGCAATGGGG - Intronic
1009986487 6:70787175-70787197 ACCTGACAAAAGGAGCAATGGGG + Intronic
1010315392 6:74442951-74442973 ACCTGACAGAAATAGCAATGGGG - Intergenic
1010321557 6:74515986-74516008 ATTTGACAAAACAAGCAATGGGG - Intergenic
1010556070 6:77281340-77281362 ACCTGACAAAACAAGCAATGGGG + Intergenic
1010918972 6:81657221-81657243 AACTAAGAATACAAGAAATGTGG + Intronic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011764192 6:90601749-90601771 ATCTGAGAAAACAATTATTGAGG - Intergenic
1011830834 6:91369468-91369490 ACCTGACAAAACAAGCAATGGGG - Intergenic
1012210826 6:96516802-96516824 AGCTGAGAAATCAAAGAATGAGG + Intergenic
1012289008 6:97427827-97427849 AGCTGAGGAAACAAGCAGTGAGG + Intergenic
1012294600 6:97505408-97505430 TGCTGAATAAACAAGCAATGGGG + Intergenic
1012540795 6:100359438-100359460 ACCTGAGAGAAACAACAATGGGG + Intergenic
1012591859 6:100991739-100991761 ACCTGACAAAAACAGCAATGGGG - Intergenic
1012688216 6:102278813-102278835 ACCAACAAAAACAAGCAATGAGG - Intergenic
1012719980 6:102728712-102728734 ACCCGACAAAACAAGCAATGGGG - Intergenic
1012830413 6:104197629-104197651 ATCAATGAAAACAAGCAATGGGG + Intergenic
1012830990 6:104203212-104203234 ACCTGACAAAACAAACAATGGGG + Intergenic
1013335047 6:109149384-109149406 ACCTGAAAAAACAAGCAACGGGG - Intronic
1013390750 6:109684124-109684146 ACCTGACACAAAAAGCAATGGGG + Intronic
1013402091 6:109807872-109807894 ATCTGACAAAACAAGCAATGGGG - Intronic
1013971941 6:116030532-116030554 ACCAGAAAGAACAAGCCATGAGG + Intronic
1014091416 6:117407939-117407961 ACCTACAAAAACAAGAAATGGGG + Intronic
1014229381 6:118886007-118886029 ACCTGAAAAATCAATCAATATGG + Intronic
1014406087 6:121052846-121052868 GACAGAGAAAAAAAGCAATGGGG - Intergenic
1014872175 6:126610265-126610287 ACCTACAAAAACAAGCAATGGGG - Intergenic
1015000128 6:128204150-128204172 ACCTGAAAAAACAAGCAATGGGG + Intronic
1016226176 6:141741224-141741246 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1017211970 6:151866991-151867013 ACCTGACAAAACAAGCAATGGGG + Intronic
1018356633 6:163024338-163024360 GCCAATGAAAACAAGCAATGGGG - Intronic
1019169606 6:170125404-170125426 ACCTGTGCAAATAAGAAATGAGG + Intergenic
1020288131 7:6701674-6701696 CCCTGAGAAAAGAAGCAAATAGG + Intronic
1020614940 7:10447481-10447503 ACCTGACAAAACAAGCAGTGGGG + Intergenic
1020690503 7:11348978-11349000 ACCTGACAAAAACAGCAATAGGG - Intergenic
1021072566 7:16259421-16259443 ACCTGAAATAACTAGAAATGGGG + Intronic
1021870125 7:24997531-24997553 ACCTGACAAAACAAGCAATGGGG - Intergenic
1021943444 7:25702516-25702538 ACCTGACAAAAACAGAAATGGGG + Intergenic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1022885334 7:34637729-34637751 ACCTGACAAAACAAGCAATGAGG + Intergenic
1023421341 7:39983284-39983306 TACTGAAAAAACAAGCAATGGGG - Intronic
1023697262 7:42860401-42860423 ACCTGACAAAAACAGCAATGGGG - Intergenic
1024040906 7:45553085-45553107 AATTGACAAAACAAGCAGTGGGG + Intergenic
1024353012 7:48386611-48386633 AACCTAAAAAACAAGCAATGGGG + Intronic
1024372480 7:48602488-48602510 ACTGGCAAAAACAAGCAATGGGG - Intronic
1024388996 7:48785923-48785945 ACTTGTGAAAACAATCAATGAGG - Intergenic
1024528878 7:50373992-50374014 TCCTGAGAAATCCAGCAATGGGG - Intronic
1024664425 7:51531816-51531838 ACCTGACAAAAACAACAATGGGG - Intergenic
1024876461 7:54029757-54029779 AGCAGAGAAAGCAAACAATGAGG + Intergenic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1026775183 7:73226765-73226787 CCCTGAGAGAGCAGGCAATGAGG - Intergenic
1027016040 7:74780136-74780158 CCCTGAGAGAGCAGGCAATGAGG - Intronic
1027071989 7:75165801-75165823 CCCTGAGAGAGCAGGCAATGAGG + Intergenic
1027451913 7:78341686-78341708 CCTGAAGAAAACAAGCAATGGGG + Intronic
1027949473 7:84796016-84796038 AATTGACAAAACAAGCAATGGGG - Intergenic
1028080732 7:86572054-86572076 ACCTGAAAAAATAAGCAATAGGG + Intergenic
1028172558 7:87615936-87615958 GACTGAGAAAGCAAGCATTGAGG + Intronic
1028689406 7:93634852-93634874 ACCTGAGAAAAGAAGTGTTGGGG - Intronic
1028767200 7:94572994-94573016 AGCTGACAAAACATGCAATGGGG - Intergenic
1030000984 7:105061852-105061874 CACTGAGAAAACTAGCAAAGGGG - Intronic
1030390820 7:108926295-108926317 ATCTGACAAAACAAGCAATGGGG - Intergenic
1030806545 7:113927152-113927174 AGCAGACAAAACAAGCAAGGGGG - Intronic
1031179132 7:118392850-118392872 ACCTGACAAAACAAGCAATGGGG + Intergenic
1031270684 7:119645351-119645373 ACGTGACAAAATAAGAAATGGGG - Intergenic
1031523582 7:122796590-122796612 ACCTGACAAAACAAGCTAGGAGG + Intronic
1031805917 7:126305763-126305785 GCCTTAGAAAAGAAGAAATGTGG - Intergenic
1033565351 7:142573248-142573270 ACCTGACAAAACAAGCAATGGGG + Intergenic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1033957408 7:146868282-146868304 AGATGACAAAACAAGCAATGAGG - Intronic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035558368 8:585041-585063 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1036109593 8:5883235-5883257 ACCTGACAAAACAAGCACTGGGG - Intergenic
1036113957 8:5937501-5937523 ACCTGACAAAACAAGCAATGGGG + Intergenic
1038842526 8:31198327-31198349 GACTGATGAAACAAGCAATGCGG - Intergenic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1039887082 8:41660955-41660977 ATCTTGGAAACCAAGCAATGGGG - Intronic
1040608115 8:48955166-48955188 ACCTGACAAAACAAGAAATGGGG - Intergenic
1040860343 8:51992438-51992460 ACCTGAAAAAACGAACAATGGGG + Intergenic
1040882818 8:52226141-52226163 AACTGAGAAAACAATGAATCTGG + Intronic
1041412214 8:57569181-57569203 ACCTGACAAAAAAAGAAATCGGG + Intergenic
1041837999 8:62238779-62238801 ACCTGACAAAACAAGCAACGGGG - Intergenic
1041947905 8:63467336-63467358 ACTTGAGAAAAGAAAAAATGTGG + Intergenic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1043730810 8:83678070-83678092 ATATGACAAAACAAGCAATGGGG + Intergenic
1043786213 8:84403423-84403445 ACTGACGAAAACAAGCAATGGGG - Intronic
1043951561 8:86315144-86315166 AGCTGAAAAAACAAACAACGGGG - Intronic
1044003678 8:86916147-86916169 TCCTGAGGAGACAAGCATTGAGG - Intronic
1044272271 8:90260210-90260232 AAATGACAAAACAAGCAATGGGG + Intergenic
1044349965 8:91152393-91152415 ACCTGACAAAACAAGCAATGGGG - Intronic
1044499725 8:92939641-92939663 ACCTGGGAAGGCAAGCAGTGTGG + Intronic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1045389186 8:101698657-101698679 ACCTCACAAAACAAGTAATGGGG + Intronic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1047837358 8:128708708-128708730 AAATGGAAAAACAAGCAATGGGG - Intergenic
1048786214 8:138053198-138053220 ACCGGAAAAAACAAGCAATGGGG - Intergenic
1048790881 8:138102191-138102213 TCCTGAGAAAGAAAGCTATGTGG - Intergenic
1048811205 8:138288342-138288364 ACCTGAGAAAAAGAGAAAAGAGG + Intronic
1049679069 8:143908743-143908765 AGCTGAGAAACCAAAGAATGAGG + Intergenic
1049913770 9:296529-296551 AGCTGAGATATCAAGGAATGGGG + Intronic
1050923707 9:11236876-11236898 ACCAACAAAAACAAGCAATGGGG - Intergenic
1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG + Intergenic
1051537094 9:18171944-18171966 ACGTGAAAAAACAAGAAATGGGG - Intergenic
1051962171 9:22780068-22780090 TGCTGACAAAACAAGCAATGGGG - Intergenic
1052287337 9:26801254-26801276 TCTTGAGAAAGAAAGCAATGAGG + Intergenic
1052701981 9:31949013-31949035 ACCAACAAAAACAAGCAATGGGG + Intergenic
1052749308 9:32473191-32473213 ACCTGAGAAAAAAAGCATTTTGG + Intronic
1055540438 9:77299024-77299046 ACCTGAAAAAACAAGCAATGGGG - Intronic
1056082507 9:83110564-83110586 ACCACAGAAGACAAGCTATGAGG + Intergenic
1056158356 9:83862440-83862462 ACCTGACAAAACAAGAAATGGGG - Intronic
1056863484 9:90208955-90208977 ACCGACAAAAACAAGCAATGGGG - Intergenic
1058384204 9:104414599-104414621 AACTGTGTAGACAAGCAATGAGG - Intergenic
1058451689 9:105102499-105102521 ATCTGAGGAAACAAGCATTAGGG - Intergenic
1058549289 9:106096611-106096633 ACCTGACAAAACAAGCAATGGGG + Intergenic
1058629931 9:106975831-106975853 AGCTGAGAACACAAGAAAGGGGG + Intronic
1058916621 9:109573047-109573069 ACTTGACAAAACAAGCAACAAGG + Intergenic
1058926661 9:109671368-109671390 ACCTGACAAAACAAGCAATAAGG - Intronic
1058986591 9:110213596-110213618 AGCTGAGCAAACAAGCAAAACGG + Intergenic
1059049993 9:110914019-110914041 ACCAAAGGAAAAAAGCAATGAGG - Intronic
1059078689 9:111223648-111223670 ACCTGACAAAACAAGCAATGGGG - Intergenic
1059262274 9:112989387-112989409 ACCTGAAAAAACAAGCAATTGGG - Intergenic
1059745763 9:117199387-117199409 AACTGACAAAAAAAGGAATGGGG - Intronic
1060643124 9:125255812-125255834 ACCTGAGAAAACTGAAAATGAGG - Intergenic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1203398162 Un_KI270519v1:47259-47281 ACCTGAGAAAAACAAGAATGGGG + Intergenic
1185812433 X:3123157-3123179 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1186350362 X:8732853-8732875 ACCTGAGGAAACAAGGCGTGTGG - Intergenic
1186815227 X:13230341-13230363 AGATGAGAAAACAAGCATAGAGG - Intergenic
1186981685 X:14963954-14963976 ACATGAATAAACAAGCACTGTGG + Intergenic
1188308595 X:28588766-28588788 ACTTGAGAAAGAAAGCACTGTGG - Intronic
1188645088 X:32555704-32555726 ACCTGAAAAAACAAGCAATGGGG + Intronic
1188771037 X:34154806-34154828 AGCAGACAAAACAAACAATGAGG - Intergenic
1188796787 X:34476801-34476823 AGCAGACAAAACAAGCAATGAGG - Intergenic
1188930959 X:36110377-36110399 AATTGACAAAAAAAGCAATGGGG - Intronic
1189597710 X:42587336-42587358 AACTCAGAAGACAAGCATTGAGG + Intergenic
1190733334 X:53238965-53238987 ACCAGAGAACACATGCACTGTGG + Intronic
1191073298 X:56425322-56425344 ACCTGACAAAAAAAGAAGTGGGG - Intergenic
1191099191 X:56706689-56706711 ACCTGACAAAACAAGCAATAGGG - Intergenic
1191177903 X:57525399-57525421 GCTGAAGAAAACAAGCAATGGGG - Intergenic
1191212145 X:57896815-57896837 AGCTGAGAAAAAAAACAATAAGG + Intergenic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191701729 X:64049142-64049164 ACCTGACAAAACAAGCAATGGGG + Intergenic
1191766160 X:64700517-64700539 CCCCCAAAAAACAAGCAATGGGG - Intergenic
1191817221 X:65259290-65259312 GCCAATGAAAACAAGCAATGAGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192427364 X:71089143-71089165 ACCTGAGGAATGAAGCATTGTGG + Intergenic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1192951353 X:76020577-76020599 ACCTGAAAAAACAAGAAATGGGG + Intergenic
1192957666 X:76090507-76090529 ACCTGACAAAACAAGCAATGGGG - Intergenic
1192964628 X:76164186-76164208 ATCTGACAAAACAAGCAACGGGG + Intergenic
1193160815 X:78227196-78227218 ACCTGCACAAACAAGCAATGGGG - Intergenic
1193163029 X:78249870-78249892 ACCTGCGAAAAAAATCAAGGAGG - Intergenic
1193199370 X:78670024-78670046 GCCTGACAAAACAAGCAATGGGG + Intergenic
1193252201 X:79304625-79304647 ACCAACCAAAACAAGCAATGAGG + Intergenic
1193277798 X:79610082-79610104 AGTTGAGCAAAAAAGCAATGGGG + Intergenic
1193318809 X:80096350-80096372 CCCTGACAAAAAAAGCAATGGGG + Intergenic
1193367775 X:80655443-80655465 ACCTGACAAAACAAGCAATGGGG + Intergenic
1193439781 X:81525397-81525419 ACCAACAAAAACAAGCAATGGGG - Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193812491 X:86068134-86068156 ACATGATAAAACAAGCAATGGGG + Intergenic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194376879 X:93147182-93147204 ACTTGAGAAAGGAAACAATGAGG + Intergenic
1194551064 X:95300122-95300144 ACCTGACAAAACAAGCAATGGGG + Intergenic
1194885534 X:99311528-99311550 ACCTCAGAACACACGGAATGGGG - Intergenic
1194918218 X:99730674-99730696 ACCTGACAAAAACAACAATGGGG + Intergenic
1195098458 X:101529209-101529231 ACCTGACAAAACAAGCAATGGGG + Intronic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1195514521 X:105758163-105758185 TCCTCTGAAAACTAGCAATGAGG + Intronic
1195789999 X:108573792-108573814 ACCTGAAAATAAAAGCAATCTGG + Intronic
1196367320 X:114938227-114938249 ACCTGACAAAACAAGCAATGGGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196776790 X:119345400-119345422 AGGTGAGAGAACAAGCCATGTGG - Intergenic
1196855415 X:119978308-119978330 ACCTGACAAAAAAAGAAACGGGG - Intergenic
1197512040 X:127381610-127381632 AGTTTACAAAACAAGCAATGTGG - Intergenic
1197532977 X:127653503-127653525 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1197680583 X:129379951-129379973 AGTTGACAAAATAAGCAATGGGG + Intergenic
1198923941 X:141765551-141765573 AACTGAGAAACAAAGAAATGGGG + Intergenic
1199058472 X:143326008-143326030 ACCTGAAAATACAGGCAAAGAGG + Intergenic
1199254613 X:145704935-145704957 ACCTGACAAAACAAGAAATGGGG + Intergenic
1199300750 X:146211041-146211063 AGTTGACAAAACAAGCAACGAGG - Intergenic
1199387917 X:147244832-147244854 ACCTGACAAAAACAGCAATGGGG + Intergenic
1199469398 X:148177406-148177428 ACCTGAAAAAACAAGAAATGGGG - Intergenic
1199519602 X:148720574-148720596 ACATGAGATAAAAAGCACTGAGG - Intronic
1199565315 X:149209486-149209508 ACCTGAAAAAGGAAGCCATGAGG + Intergenic
1199665467 X:150093269-150093291 ACTTGAGAAAACAGGCCCTGAGG + Intergenic
1199748067 X:150787940-150787962 AATTGACAAAACAAGCAGTGGGG - Intronic
1199994758 X:153015354-153015376 AGTTGAGAAAAACAGCAATGAGG + Intergenic
1200885865 Y:8268960-8268982 ACCTGACAAAACAAGCAATGGGG + Intergenic
1201186065 Y:11404048-11404070 CCTTGTAAAAACAAGCAATGGGG - Intergenic
1201488734 Y:14519187-14519209 ATCAGAGAGAACAAGTAATGTGG + Intergenic
1201594824 Y:15656699-15656721 ACCTGAGAAACCTAGCAAAGTGG + Intergenic
1201596328 Y:15673653-15673675 ACCTGAGAAAAACAGAAATGGGG - Intergenic
1201599989 Y:15717868-15717890 ACCAGACAAAACAAGAATTGGGG + Intergenic
1201647462 Y:16251350-16251372 ACCCGCAGAAACAAGCAATGGGG + Intergenic
1201655349 Y:16333951-16333973 ACCCGCAGAAACAAGCAATGGGG - Intergenic
1201664900 Y:16439844-16439866 ACCAGAGAAAATTAGCAGTGAGG - Intergenic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202084783 Y:21124790-21124812 ACCTGACAAAATAAGAAATGGGG - Intergenic