ID: 1191581490

View in Genome Browser
Species Human (GRCh38)
Location X:62766906-62766928
Sequence AGAGACTGCTTTGTGACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191581490_1191581492 6 Left 1191581490 X:62766906-62766928 CCACACGTCACAAAGCAGTCTCT No data
Right 1191581492 X:62766935-62766957 GCTTCTTTCTGGTTTTTATTTGG No data
1191581490_1191581494 30 Left 1191581490 X:62766906-62766928 CCACACGTCACAAAGCAGTCTCT No data
Right 1191581494 X:62766959-62766981 AATATTCAGTTATTCACCATAGG No data
1191581490_1191581491 -5 Left 1191581490 X:62766906-62766928 CCACACGTCACAAAGCAGTCTCT No data
Right 1191581491 X:62766924-62766946 TCTCTCTGATAGCTTCTTTCTGG No data
1191581490_1191581493 7 Left 1191581490 X:62766906-62766928 CCACACGTCACAAAGCAGTCTCT No data
Right 1191581493 X:62766936-62766958 CTTCTTTCTGGTTTTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191581490 Original CRISPR AGAGACTGCTTTGTGACGTG TGG (reversed) Intergenic