ID: 1191586519

View in Genome Browser
Species Human (GRCh38)
Location X:62833284-62833306
Sequence CCCATTAGGTCCCACCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191586514_1191586519 -6 Left 1191586514 X:62833267-62833289 CCATGATCCTGACACCTCCCATT No data
Right 1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG No data
1191586512_1191586519 -4 Left 1191586512 X:62833265-62833287 CCCCATGATCCTGACACCTCCCA No data
Right 1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG No data
1191586513_1191586519 -5 Left 1191586513 X:62833266-62833288 CCCATGATCCTGACACCTCCCAT No data
Right 1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191586519 Original CRISPR CCCATTAGGTCCCACCTAAT TGG Intergenic
No off target data available for this crispr