ID: 1191588239

View in Genome Browser
Species Human (GRCh38)
Location X:62852037-62852059
Sequence TTGTACCCCTTCCATTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191588233_1191588239 28 Left 1191588233 X:62851986-62852008 CCACAAGGTGACCAGACAAGCTA No data
Right 1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG No data
1191588234_1191588239 17 Left 1191588234 X:62851997-62852019 CCAGACAAGCTACCTGTTACATT No data
Right 1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG No data
1191588237_1191588239 5 Left 1191588237 X:62852009-62852031 CCTGTTACATTGGACCAGGTTAG No data
Right 1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG No data
1191588238_1191588239 -9 Left 1191588238 X:62852023-62852045 CCAGGTTAGTTACATTGTACCCC No data
Right 1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191588239 Original CRISPR TTGTACCCCTTCCATTATGA AGG Intergenic
No off target data available for this crispr