ID: 1191602954

View in Genome Browser
Species Human (GRCh38)
Location X:63030599-63030621
Sequence CTAGTCCTGCCCTTGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191602950_1191602954 0 Left 1191602950 X:63030576-63030598 CCTCATGATCTAGCTACCTCCAC No data
Right 1191602954 X:63030599-63030621 CTAGTCCTGCCCTTGACACATGG No data
1191602949_1191602954 1 Left 1191602949 X:63030575-63030597 CCCTCATGATCTAGCTACCTCCA No data
Right 1191602954 X:63030599-63030621 CTAGTCCTGCCCTTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191602954 Original CRISPR CTAGTCCTGCCCTTGACACA TGG Intergenic
No off target data available for this crispr