ID: 1191605579

View in Genome Browser
Species Human (GRCh38)
Location X:63058491-63058513
Sequence GCTGCATTTCACCTCTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191605579_1191605580 1 Left 1191605579 X:63058491-63058513 CCATGAAAGAGGTGAAATGCAGC No data
Right 1191605580 X:63058515-63058537 GCATTTAGTCAGCCATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191605579 Original CRISPR GCTGCATTTCACCTCTTTCA TGG (reversed) Intergenic
No off target data available for this crispr