ID: 1191605580

View in Genome Browser
Species Human (GRCh38)
Location X:63058515-63058537
Sequence GCATTTAGTCAGCCATCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191605579_1191605580 1 Left 1191605579 X:63058491-63058513 CCATGAAAGAGGTGAAATGCAGC No data
Right 1191605580 X:63058515-63058537 GCATTTAGTCAGCCATCTTAAGG No data
1191605577_1191605580 6 Left 1191605577 X:63058486-63058508 CCCTTCCATGAAAGAGGTGAAAT No data
Right 1191605580 X:63058515-63058537 GCATTTAGTCAGCCATCTTAAGG No data
1191605578_1191605580 5 Left 1191605578 X:63058487-63058509 CCTTCCATGAAAGAGGTGAAATG No data
Right 1191605580 X:63058515-63058537 GCATTTAGTCAGCCATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191605580 Original CRISPR GCATTTAGTCAGCCATCTTA AGG Intergenic
No off target data available for this crispr