ID: 1191609742

View in Genome Browser
Species Human (GRCh38)
Location X:63100156-63100178
Sequence CACCTGGTCCAACCAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 3, 1: 54, 2: 81, 3: 81, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191609742_1191609746 0 Left 1191609742 X:63100156-63100178 CCCAAAATTGGTTGGACCAGGTG 0: 3
1: 54
2: 81
3: 81
4: 177
Right 1191609746 X:63100179-63100201 TGATGTTTACATAACACACAGGG No data
1191609742_1191609747 4 Left 1191609742 X:63100156-63100178 CCCAAAATTGGTTGGACCAGGTG 0: 3
1: 54
2: 81
3: 81
4: 177
Right 1191609747 X:63100183-63100205 GTTTACATAACACACAGGGAAGG No data
1191609742_1191609748 7 Left 1191609742 X:63100156-63100178 CCCAAAATTGGTTGGACCAGGTG 0: 3
1: 54
2: 81
3: 81
4: 177
Right 1191609748 X:63100186-63100208 TACATAACACACAGGGAAGGTGG No data
1191609742_1191609745 -1 Left 1191609742 X:63100156-63100178 CCCAAAATTGGTTGGACCAGGTG 0: 3
1: 54
2: 81
3: 81
4: 177
Right 1191609745 X:63100178-63100200 GTGATGTTTACATAACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191609742 Original CRISPR CACCTGGTCCAACCAATTTT GGG (reversed) Intergenic
905080007 1:35310222-35310244 CACCTCGTCCAAGCATTTTATGG + Intronic
905110614 1:35591838-35591860 CACCAGGCCCAGCTAATTTTTGG + Intronic
906998981 1:50830269-50830291 CACCATGTCCAACTAATTTTTGG + Intronic
907887377 1:58606017-58606039 CACCTGGTCCAACCAATCTTTGG - Intergenic
909600231 1:77453999-77454021 CACCTGGTCCAAAAAGTTTGAGG + Intronic
911648721 1:100363041-100363063 CACCTGGTTGAACCAATCTGCGG - Intronic
911957886 1:104261239-104261261 CACCTGGTCTGACCAATCTCTGG + Intergenic
912819053 1:112852415-112852437 CACCTGGTCCAACCAATCTTTGG - Intergenic
912938373 1:114023527-114023549 CACTTGGTCCAACCAATCTGTGG + Intergenic
913667101 1:121058440-121058462 CACCTGGTCCAACCAATCTTTGG - Intergenic
914018793 1:143845592-143845614 CACCTGGTCCAACCAATCTTTGG - Intergenic
914657345 1:149753795-149753817 CACCTGGTCCAACCAATCTTTGG - Intergenic
915537621 1:156546729-156546751 CTCCTGGTCCTACCACTTCTGGG - Intronic
916042817 1:160975920-160975942 CACCTGGTCCAACCAATCTTTGG - Intergenic
917956399 1:180103103-180103125 CACCTGGTGGAACCAATCTGTGG - Intronic
918460485 1:184771477-184771499 CACCTGGTGGAACCAATCTGTGG + Intergenic
918625485 1:186652108-186652130 CACCTGATCCAACCAATCTTTGG + Intergenic
918912476 1:190591653-190591675 CACCTGGTCCAACCAATGTTTGG - Intergenic
919047809 1:192475633-192475655 CACCTGATCAAACCAATCTTTGG + Intergenic
919368070 1:196690762-196690784 CACCTAGTTTAACCAATCTTTGG - Intronic
919380845 1:196858931-196858953 CACCTGGTCCAATCAATCTTTGG - Intronic
919731877 1:200918027-200918049 CACCATGTCCAGCTAATTTTTGG + Intergenic
920391685 1:205607457-205607479 CACCACGTCCAGCTAATTTTGGG + Intronic
920957435 1:210632429-210632451 CACCTGGTCCAACCAATCTTTGG - Intronic
921413763 1:214866938-214866960 CACCTGGTTGAACCAATCTGTGG + Intergenic
921836334 1:219782537-219782559 CACCTGGTCCAACCAATCTTTGG + Intronic
922212577 1:223497159-223497181 CACCTGGTCCAACCAATCTGTGG + Intergenic
923823247 1:237471023-237471045 TACCGAGTCCAACCAATCTTTGG - Intronic
924723593 1:246646124-246646146 CACCTTGCCCAGCTAATTTTTGG - Intronic
924933520 1:248748701-248748723 CACTTGGACCAACCATTTTCAGG - Intronic
1063020251 10:2119785-2119807 CACGTGGTCCAACCAATCTTTGG - Intergenic
1063689803 10:8276017-8276039 CACCTGGTCCAACCAATCTGTGG - Intergenic
1063740132 10:8808151-8808173 CACCTGGTCAAACCAATCTCTGG - Intergenic
1063820096 10:9824932-9824954 CACCTGTTCCAACCAATCTGTGG - Intergenic
1063852947 10:10213689-10213711 CACCTGGTCTAATCAATCTTTGG - Intergenic
1064215935 10:13400682-13400704 CACCTGGTCCAACCAATCTTTGG - Intergenic
1064216504 10:13405089-13405111 CACCTGATCCAACCAATCTTTGG + Intergenic
1064469964 10:15626124-15626146 CACCTGGTCCAACCAATCTTTGG + Intronic
1064953206 10:20877764-20877786 CGCCTGGTCCAACCAATCTGTGG + Intronic
1065442198 10:25764145-25764167 CACCTGGTCCAACCTATCTTTGG + Intergenic
1065455037 10:25898460-25898482 CATCTGGTCCAACCAATCTTTGG + Intergenic
1065502403 10:26395077-26395099 CACCTGGTCCAACCAATCTTTGG + Intergenic
1068297908 10:55098697-55098719 CACCTGGTGGAACCAATTTGCGG + Intronic
1068578228 10:58708605-58708627 CACCTGGTCCAACCAATCTTCGG - Intronic
1068601413 10:58960910-58960932 CACCTGGTTGAACCAATCTGTGG + Intergenic
1069380409 10:67838646-67838668 CACCATGTCCAGCTAATTTTTGG + Intergenic
1070461166 10:76671913-76671935 CACCTGGTGGAACCAATCTGTGG - Intergenic
1071961726 10:90813886-90813908 CACCTGGTCCAACCAATCTATGG + Intronic
1072353785 10:94585859-94585881 CACCAGGTCCAGCTAATTTTTGG + Intronic
1072404191 10:95134170-95134192 CCCCTGGTCCAACCAATCTGTGG - Intergenic
1073893956 10:108132487-108132509 CACTTTGTCCAACCAGTCTTTGG - Intergenic
1074311853 10:112329181-112329203 CACCTGGTCCAACCAATCTTTGG + Intergenic
1074691699 10:116011515-116011537 CACCTGGTCCAACCAATCTTTGG - Intergenic
1074997980 10:118774179-118774201 CACCACGCCCAACTAATTTTTGG + Intergenic
1078268416 11:9772498-9772520 CACCTGGTCCAACCAATCTTTGG + Intergenic
1080249381 11:30215892-30215914 CACTTAGTCCAACCAATCTTTGG - Intergenic
1080449277 11:32365281-32365303 TGCCTGGTCCAACCAATCTTTGG - Intergenic
1082864567 11:57886875-57886897 CACCAGCACCAACCAATGTTTGG - Intergenic
1086061734 11:82707129-82707151 CACCTCATCCAGCCAATTCTAGG - Intergenic
1087322169 11:96676617-96676639 CATTTGGTCCAACCAATCTGTGG - Intergenic
1087340331 11:96897787-96897809 CACCTGGTCCAACCAATCTTTGG + Intergenic
1087650497 11:100861485-100861507 TACCTGGGCAAACCAGTTTTGGG + Intronic
1088099782 11:106142745-106142767 CACCTGGTCAAACCAATCTGTGG - Intergenic
1088167752 11:106957795-106957817 CAACTGCTCCAACCAAGTGTTGG + Intronic
1088231954 11:107682095-107682117 CACCACGCCCAACTAATTTTTGG - Intergenic
1088422610 11:109666018-109666040 CACCTGGTCCAACCAATCTGTGG + Intergenic
1088799861 11:113295800-113295822 CACCTGATCGAACCAATCTGTGG + Intergenic
1092793368 12:12088304-12088326 CACCTGGTTCAACTGATCTTTGG - Intronic
1093902176 12:24648283-24648305 CACCAGGCCCAGCTAATTTTTGG + Intergenic
1094248217 12:28327497-28327519 CACCTGGTCCAACCAATCTTTGG + Intronic
1094596587 12:31871787-31871809 CACCTGGTCTAACCAATCTTTGG - Intergenic
1095404835 12:41856456-41856478 CACCTGGTCCAACCAGTCTGTGG + Intergenic
1095526556 12:43132905-43132927 AAGCTGGTTCAAACAATTTTAGG + Intergenic
1096896252 12:54823089-54823111 CACCTGGTCCAACCAATCTTTGG + Intergenic
1097400011 12:59117283-59117305 CACCTGGTTAAACCAATCTGTGG + Intergenic
1098663563 12:73131194-73131216 CATCATGTCCAACTAATTTTTGG - Intergenic
1100363250 12:93897115-93897137 CACCTGGTCCAACCAACCTTTGG - Intergenic
1100815781 12:98385884-98385906 CACCTGGTCCAACCATCTTTGGG + Intergenic
1101426216 12:104590766-104590788 CACCATGTCCAGCTAATTTTTGG - Intronic
1101860398 12:108477863-108477885 CACCTGATCCAGCCAATCTGCGG + Intergenic
1102482258 12:113232044-113232066 CACATGGTCCAGCCCATCTTAGG - Intronic
1103139221 12:118534266-118534288 CATCTGGTCCAACCAATCTTTGG + Intergenic
1104303982 12:127592742-127592764 CACCTGGTCCAACCAATCTTTGG - Intergenic
1104346577 12:128005068-128005090 CACCTGGTCCAACCAATCTTTGG - Intergenic
1106565933 13:30884707-30884729 CACTAGGTCCAACCAATCTTTGG - Intergenic
1108768208 13:53662069-53662091 CACCATGTCCAGCTAATTTTTGG + Intergenic
1109660899 13:65458877-65458899 TACCTGGTCCAACTAATCTATGG - Intergenic
1109985911 13:69984533-69984555 CACCTGGTCCAACCAATCTTTGG + Intronic
1111343513 13:86918875-86918897 CACCTAGTCCAACCAGTTTTGGG - Intergenic
1111530175 13:89526390-89526412 CACTTGATCCAACCAATTTTTGG - Intergenic
1111577540 13:90176041-90176063 CACCTGGTCCAACCAATCTGTGG + Intergenic
1112082053 13:95982524-95982546 TACCTGCTCCAACCAATTTGTGG + Intronic
1112286075 13:98105548-98105570 CACCTGGTTCAACCAATCTTTGG + Intergenic
1112673688 13:101672605-101672627 CACCTGATCCAATCAATCTGTGG + Intronic
1113011104 13:105766617-105766639 AACCTGGGCTAACCAATTCTTGG - Intergenic
1113260194 13:108553170-108553192 CACCACGCCCAACTAATTTTTGG + Intergenic
1113647835 13:112011508-112011530 CACCACGCCCAACTAATTTTTGG + Intergenic
1117416380 14:55500345-55500367 CACCTGGTCCAACCAATCTTCGG + Intergenic
1117868582 14:60174626-60174648 CATCTGGTCCAACCAATCTGTGG + Intergenic
1117976368 14:61300953-61300975 CACCTGGTCCAACCGATCTTTGG + Intronic
1118208933 14:63749061-63749083 CACCTGGTATAACCAATCTGTGG + Intergenic
1119742123 14:77020694-77020716 CACCTTGCCCAGCTAATTTTTGG + Intergenic
1121137747 14:91513320-91513342 CACCACGTCCAGCTAATTTTTGG + Intergenic
1122646981 14:103201379-103201401 CACCTGGTTGAACCAATCTGTGG - Intergenic
1123434396 15:20244581-20244603 CACCACGCCCAACTAATTTTTGG - Intergenic
1123540533 15:21285309-21285331 CACCTGATCAAACCAATCTGTGG - Intergenic
1123977487 15:25566970-25566992 CAACGGGTCCAACCAATCTTTGG + Intergenic
1125624276 15:41093692-41093714 CACCACGTTCAACTAATTTTTGG - Intronic
1126216072 15:46156678-46156700 CACCTGGTCCAACCAATCTGTGG - Intergenic
1128011699 15:64303324-64303346 CACCATGCCCAGCCAATTTTTGG - Intronic
1129647376 15:77448956-77448978 CTCCTGGTTCAAGCAATTCTCGG - Intronic
1129914601 15:79257717-79257739 CACCTGGTCAAACCAATCTGTGG + Intergenic
1130662882 15:85844437-85844459 CACCATGCCCAACTAATTTTTGG - Intergenic
1130829709 15:87586945-87586967 CACCTCATCAAACCAATTTAAGG + Intergenic
1131812742 15:96189695-96189717 CACCTTGCCCAGCTAATTTTTGG + Intergenic
1202948847 15_KI270727v1_random:12451-12473 CACCTGATCAAACCAATCTGTGG - Intergenic
1133362825 16:5187490-5187512 CATCTGGTCCAACCAATCTTTGG - Intergenic
1134119907 16:11576313-11576335 CACCTTGCCCAGCTAATTTTTGG - Intronic
1134386666 16:13779863-13779885 CACCTGATCCAACCAATCTGTGG + Intergenic
1134567266 16:15262375-15262397 CACCTGGTGCAACCAATCTTTGG - Intergenic
1134593279 16:15474839-15474861 CACCACGTCCAGCTAATTTTTGG + Intronic
1134606701 16:15577002-15577024 CACCTGCTCCAACCAATCTGTGG - Intronic
1134735225 16:16494325-16494347 CACCTGGTGCAACCAATCTTTGG + Intergenic
1134932296 16:18217892-18217914 CACCTGGTGCAACCAATCTTTGG - Intergenic
1135683452 16:24478652-24478674 CACCTGGTCCAACCAATCTGTGG + Intergenic
1137840035 16:51632282-51632304 CAAGTGGTCCAAGCAATTTTTGG + Intergenic
1138727176 16:59152583-59152605 TGCCTGGTCCAACCAATCTTTGG - Intergenic
1138898593 16:61240946-61240968 CACCTGGTCCAACCAATCTTTGG + Intergenic
1140314500 16:73881861-73881883 CACCAGGTGCTAGCAATTTTAGG - Intergenic
1140533972 16:75692164-75692186 CATCTGGTCTGACCAATCTTTGG + Intronic
1141178450 16:81736080-81736102 CACCATGTCCAACTAATTTTTGG + Intergenic
1141412688 16:83846150-83846172 CACCTGGTCCAACCAATCTGTGG - Intergenic
1142654094 17:1378791-1378813 CACCATGCCCAACTAATTTTTGG - Intronic
1145873259 17:28294318-28294340 CACCATGCCCAACTAATTTTGGG + Intergenic
1146596546 17:34174154-34174176 CACCTGGTCCAACCAATCTGTGG - Intronic
1147414123 17:40276237-40276259 CACCAGGCCCAGCCAATTCTGGG - Intronic
1149041784 17:52198634-52198656 CACCTGCTCCAATCAATCTTTGG - Intergenic
1150643907 17:66966238-66966260 CACCTGGTCCCAGCAAGGTTGGG + Intronic
1151080531 17:71324137-71324159 CACCTCGTCCAACCAATCTTTGG + Intergenic
1151264634 17:72945305-72945327 CCTCTGGTCGAACCAATTATGGG + Intronic
1151735318 17:75936336-75936358 CACCAGGCCCAGCTAATTTTGGG - Intronic
1153954389 18:10083698-10083720 CACCTGAACCAACCAATCATTGG - Intergenic
1155448924 18:25943240-25943262 CACCTAATCCAACCAATCTTTGG + Intergenic
1155482839 18:26308098-26308120 CACCATGCCCAACTAATTTTGGG - Intronic
1155769852 18:29682829-29682851 CACTTGGTCCAACCAATCTTTGG - Intergenic
1156715661 18:40006854-40006876 CTCCTGGTCCAACCAATCTGTGG + Intergenic
1157847149 18:51014499-51014521 CACCTGGTCGAACCAATCTGTGG + Intronic
1159440818 18:68477903-68477925 CACCTGTTCAAACCAATCTGTGG + Intergenic
1159674533 18:71265410-71265432 CACCACGCCCAACTAATTTTTGG + Intergenic
1159676304 18:71287881-71287903 TACTTGGTCCAACCACTCTTTGG + Intergenic
1159915662 18:74185364-74185386 CACCTGGTCCAACCAATTTTTGG - Intergenic
1161826934 19:6574031-6574053 CACCTGGTCGAACCAATCTGTGG - Intergenic
1161873063 19:6885559-6885581 CACCTGGTCCAACTAATCTTTGG + Intergenic
1161878355 19:6929356-6929378 CACTGGGTCCAACCAATCTTTGG - Intronic
1161935523 19:7369508-7369530 CACCGTGCCCAGCCAATTTTAGG - Intronic
1162864806 19:13537753-13537775 CACCTGGTCCAACCAATCCTTGG + Intronic
1163047686 19:14656527-14656549 CACCTGGCCCAACCAATCTGTGG - Intronic
1163061015 19:14761816-14761838 CACCTGTTCCAACCAATCTTTGG + Intronic
1163227748 19:15976800-15976822 CACCTGGTCCAACCAATCTTTGG - Intergenic
1163227808 19:15977296-15977318 CTCCTGGTCCAACCAACCTTTGG - Intergenic
1163283163 19:16329716-16329738 CACCAAGCCCAACTAATTTTTGG + Intergenic
1164236166 19:23336397-23336419 TACCTGATCCAGCCAATCTTTGG - Intronic
1164321678 19:24153723-24153745 AACCTGATCCAACCAATGTTTGG + Intergenic
1164763667 19:30746622-30746644 CACCTGGTCCAGCCAATCTTTGG - Intergenic
1165172398 19:33903289-33903311 CACCTAGTCCAACCAATCTTTGG - Intergenic
1165612756 19:37170635-37170657 CACCATGTCCAGCTAATTTTTGG + Intronic
1166147315 19:40846601-40846623 CACCATGCCCAACTAATTTTTGG + Intronic
1166917497 19:46205493-46205515 CAGCTGATCCAACCAATCTGTGG + Intergenic
1168313323 19:55472619-55472641 TTCCTGGTCCAACCACTTCTGGG + Intergenic
1168444259 19:56398208-56398230 CACCTGGTCCAACCAATCTTTGG - Intronic
926380725 2:12286564-12286586 CACTTGGTCCAACCAATCTTTGG - Intergenic
926829715 2:16948185-16948207 CACCTGGTTGAACCAATTTGTGG - Intergenic
926832498 2:16978907-16978929 CACCATGTCCAACCACTTTTAGG - Intergenic
927911824 2:26905102-26905124 CATCTGGTCCAGCAAAATTTGGG - Intronic
928863374 2:35887364-35887386 CACCTGGTTCAACCAATCTGTGG + Intergenic
929213279 2:39383120-39383142 CACCTAGTCTAATCAACTTTGGG - Intronic
930494619 2:52125802-52125824 CACCTGGTCCAACCAATCTGTGG - Intergenic
930621766 2:53651545-53651567 CAATTGGTCCAACCAATCTGTGG + Intronic
930622003 2:53653228-53653250 CACGTGGTCCAACCAATCTGTGG - Intronic
931422127 2:62137915-62137937 CACCTGCAACAACCAGTTTTTGG - Intronic
931448513 2:62347600-62347622 CACCTGGTCCAACCAATCTGTGG - Intergenic
931561910 2:63571056-63571078 CACTAGGTCCAGCTAATTTTTGG + Intronic
931877915 2:66534232-66534254 CACCTCTTAAAACCAATTTTTGG + Intronic
932928734 2:76008245-76008267 CACCAGGTCCAACCAATCTGTGG + Intergenic
933659768 2:84917814-84917836 CACCTGGTCCAACCAATCTGTGG - Intergenic
935190093 2:100770638-100770660 CACCTGGCCCACACCATTTTTGG - Intergenic
935364495 2:102275192-102275214 CACCTGGTCCAACCAATCTGTGG + Intergenic
935715309 2:105934098-105934120 CACCTGGTCAAACCAATCTGGGG - Intergenic
935782599 2:106521161-106521183 CACCTGGTCCAACCAATCTGTGG - Intergenic
935850845 2:107217119-107217141 CACCTGGTCCAATGAATCTGTGG + Intergenic
936626561 2:114155341-114155363 CACCTGGTCCAACCAATCTTTGG + Intergenic
936771583 2:115920206-115920228 CATCTAGTTCAACCAATCTTTGG - Intergenic
939131670 2:138242843-138242865 CACCTGATCCAACCAATCTGTGG - Intergenic
939353256 2:141068419-141068441 CACCTGGTCCGACCAATCTTTGG - Intronic
939844060 2:147221958-147221980 TAGCTGGTCCAACCAATCTTTGG + Intergenic
940486555 2:154303299-154303321 CACCTGATCCAACCATTCTGTGG - Intronic
941397735 2:164993761-164993783 CACCTGATCAAACCAATTTGTGG - Intergenic
943127059 2:183806814-183806836 CACCTGGTCCAACCAATCTTTGG + Intergenic
943764729 2:191648434-191648456 CACCATGCCCAACTAATTTTTGG + Intergenic
943888903 2:193259946-193259968 CACCATGCCCAACTAATTTTTGG + Intergenic
943984498 2:194602960-194602982 CACCTGGTCGAATCAATCTGTGG + Intergenic
943985328 2:194611218-194611240 CACCTCGTCAAACCAATCTGTGG + Intergenic
945936461 2:215907357-215907379 CACCTGGCCCAACCAATCTTTGG - Intergenic
946442480 2:219708326-219708348 CATCTGGTCCAACCATGTTCTGG + Intergenic
947282734 2:228473513-228473535 CACCTAATCCAACCAATCCTTGG - Intergenic
947446014 2:230163136-230163158 CATGTGGTCCAACCAATCTGTGG - Intergenic
1169846890 20:10003554-10003576 CATCTGGTCCAACCAATCTGTGG - Intronic
1169948560 20:11015803-11015825 CACCTGGTCCAACCAATCTTTGG + Intergenic
1169983326 20:11411997-11412019 CACCTGGTCCAACCAATCTTTGG + Intergenic
1169992382 20:11517798-11517820 CACCTGGTCCAACCAATCTTTGG - Intergenic
1170068237 20:12338852-12338874 CACCTGGTCCAACCAATCTGTGG - Intergenic
1170308931 20:14971715-14971737 CACCTGATCCAACCAATCTTTGG - Intronic
1170413299 20:16113482-16113504 CACCTGGTTCAACCAATCTCTGG - Intergenic
1170506857 20:17035455-17035477 CACCTGGTCCAACCAATCTGTGG - Intergenic
1171367570 20:24636489-24636511 CACCTGGTCCAACCAATCTTTGG - Intronic
1173286230 20:41673633-41673655 CACTTGGTCCAACCAACCTTAGG + Intergenic
1174157517 20:48525480-48525502 CAGCAGGTGCAGCCAATTTTAGG + Intergenic
1176996206 21:15558200-15558222 CACCTGGTAGAACCAATCTGTGG + Intergenic
1178271492 21:31193983-31194005 CACCTGGTCCAAACAATCTGTGG + Intronic
1179075897 21:38121417-38121439 CCCCTGGTCGAACCAATCTCTGG - Intergenic
1182487438 22:30647837-30647859 CCCCTGGGCCCCCCAATTTTGGG + Exonic
1182648598 22:31831414-31831436 CACCTGGCCAAAACAATTTTAGG - Intronic
1183247674 22:36706420-36706442 CACCTTGCCCAGCCAATTTTTGG + Intergenic
949115479 3:316009-316031 CACCTGATCGAACCAATCTGTGG - Intronic
949336488 3:2980827-2980849 CACCTGGTCTATCCAATCTTTGG - Intronic
951500206 3:23377577-23377599 CACCAGGTCCTCCCAATATTTGG - Intronic
951742977 3:25944477-25944499 CATCTGGTTCAACCAATCTGTGG - Intergenic
953327136 3:42021987-42022009 TACCTGTTCCAAACTATTTTTGG - Intronic
954651567 3:52167381-52167403 CACCTGGTCAAACCAATTCCCGG + Intergenic
955568618 3:60277614-60277636 CACCTCGTCCAACCAATCTTTGG + Intronic
956480598 3:69670091-69670113 CACCATGTCCAGCTAATTTTTGG + Intergenic
957108898 3:75927483-75927505 CAACTAAGCCAACCAATTTTTGG + Intronic
957478548 3:80759066-80759088 CACCTGGTCCAACCAATCCATGG - Intergenic
959500537 3:107101772-107101794 CACCTGGTCCAACCAATCTTTGG + Intergenic
960842290 3:121972311-121972333 CACCTGGTCCAACCAATCTTTGG + Intergenic
961747421 3:129073540-129073562 CACCTTGCCCAGCTAATTTTTGG + Intergenic
963893175 3:150658554-150658576 CACCTAGTCCAACCAAACTATGG + Intergenic
963897568 3:150703423-150703445 CACCTGGTCCACCCACTCCTGGG - Intronic
964366128 3:155952522-155952544 CACCTGGTCCAACCAATCTTTGG - Intergenic
964777553 3:160294507-160294529 CACCATGTCCAGCCAACTTTTGG + Intronic
965390836 3:168101526-168101548 CAAATGGTCCAATCCATTTTAGG - Intergenic
965437550 3:168671349-168671371 AACCTGGTCCAACCAATCTTTGG + Intergenic
966299203 3:178460086-178460108 CACCTGATCAAACCAATCTGTGG - Intronic
966308535 3:178566066-178566088 CATCTGGTTCAACCATCTTTGGG - Intronic
967070110 3:185955594-185955616 CACCTGGTCAAACCAATCTGTGG - Intergenic
968120066 3:196119842-196119864 CACCATGCCCAGCCAATTTTTGG - Intergenic
968848384 4:3060878-3060900 TGCCTGGTCCAACCAATCTTTGG + Intergenic
969435631 4:7187700-7187722 CACCTGGCCCCACCAGGTTTTGG + Intergenic
971023713 4:22566575-22566597 CACCACGTCCAGCTAATTTTTGG - Intergenic
971968275 4:33591382-33591404 CACCTGACCCAACCAAACTTAGG + Intergenic
971969211 4:33600102-33600124 CACTTGGTCCAACCAATCTTTGG + Intergenic
972179490 4:36446069-36446091 CACCTGGTTGAACCAATCTGTGG - Intergenic
972564765 4:40259855-40259877 CACCTGATCAAACCAATCTGTGG - Intergenic
972744976 4:41923907-41923929 CACCTGGTCCAACCATTCTTTGG + Intergenic
973887372 4:55336901-55336923 CTCCTGCTCCAGCCAATCTTTGG - Intergenic
974439515 4:61898545-61898567 CACCTGGTCCAGCCAATCTTGGG - Intronic
974833307 4:67216129-67216151 CACCGTGTCCAGCCAAATTTAGG - Intergenic
975264245 4:72343103-72343125 CACCTGGTCCAACTAATCTGTGG - Intronic
975682392 4:76889531-76889553 CACCACATCCAACTAATTTTAGG - Intergenic
975856393 4:78629474-78629496 CACCTGGTCCAACCAATCTGTGG - Intergenic
976316494 4:83664316-83664338 CACCTGGTCCAACCAATCTTTGG + Intergenic
976465407 4:85362674-85362696 CACCTGGCCCAACCAATCTTTGG - Intergenic
976575565 4:86666732-86666754 CACCTGGTCCAGCCAATCTGTGG - Intronic
979361900 4:119774953-119774975 CACCTGGTCCAACCAATCTTTGG - Intergenic
980683823 4:136200028-136200050 CACCCGCTGCTACCAATTTTAGG + Intergenic
980693527 4:136327822-136327844 CAGCTGGTCCAACCAATCTGCGG - Intergenic
982096929 4:151931734-151931756 CACCTGGTCCAACCAATCTTTGG - Intergenic
983434933 4:167701092-167701114 CATGTGATCCAACCATTTTTTGG + Intergenic
983516058 4:168657858-168657880 CACCTGGTCCAACCAATCTGTGG + Intronic
984466290 4:180102683-180102705 TACCAGGTCCATGCAATTTTTGG - Intergenic
985054794 4:186026812-186026834 CTCCTGTTCCAACCCATTTATGG - Intergenic
985165778 4:187092628-187092650 CACTTGGTAGAACCAATTTCTGG - Intergenic
985345583 4:189001524-189001546 GACCTGGTCCAACCAATCTTTGG + Intergenic
985482714 5:126927-126949 CACCTGGTCCAACCAATCTGTGG - Intergenic
986212719 5:5689441-5689463 CACCCGGTCCAACCAATCTTTGG - Intergenic
986268530 5:6211289-6211311 CACCTGGTCCAACCAATCTTTGG - Intergenic
986398194 5:7351684-7351706 CACCTGGTGGAACCAATATGGGG + Intergenic
987389316 5:17361081-17361103 CACCTGGTCAAACCAATCTGTGG - Intergenic
987607235 5:20153094-20153116 CACCACGTCCAGCTAATTTTTGG + Intronic
987860240 5:23477068-23477090 CACCTGCTCCAGTCATTTTTTGG - Intergenic
988633088 5:32952056-32952078 CACCTGGCCAAACCAATCTGTGG - Intergenic
989189894 5:38660472-38660494 CACCTGGTCCAACCAATGTTTGG + Intergenic
989691342 5:44148318-44148340 CACCTGGACCAGCCCCTTTTGGG - Intergenic
990438982 5:55824780-55824802 CACCTGGTTCAACCAATCTTTGG - Intergenic
992069687 5:73137189-73137211 CACCTGATCGAACCAATCTGTGG - Intergenic
992589263 5:78276577-78276599 CACCAAGTCCAACTAATTTTTGG - Intronic
993315473 5:86400202-86400224 CACCTGGTACTTCCAATTATGGG - Intergenic
993966330 5:94365083-94365105 CACCTGCTCCAACCAGTCTGTGG + Intronic
994374872 5:99008076-99008098 CAACTGGTCCAACAATATTTTGG - Intergenic
996700256 5:126443896-126443918 CACCACGTCCAGCTAATTTTTGG - Intronic
997427085 5:133810679-133810701 CACCTGGTCCAACGAATCTTTGG - Intergenic
997497453 5:134341860-134341882 CACCTGGTCGAACCAATCTGTGG + Intronic
1002288367 5:178180723-178180745 CACCTGGTCCAGCCAATCTTTGG + Intergenic
1002953887 6:1842951-1842973 CACCATGTCCAGCTAATTTTTGG - Intronic
1003694318 6:8388101-8388123 CACCTGGTCTGACCAATCTTTGG - Intergenic
1004284700 6:14310431-14310453 CACTTGGGTCACCCAATTTTAGG - Intergenic
1006051751 6:31350677-31350699 CACCTGGTACAACCAACCTGTGG - Intronic
1006061517 6:31423693-31423715 CACCTGGTCCAACCAATCTGTGG - Intergenic
1009770770 6:68140550-68140572 CACCTGGTCCAACCAATCTTTGG + Intergenic
1009885766 6:69622287-69622309 CACCTGGTCCAACCAATCTTTGG - Intergenic
1011927391 6:92663591-92663613 CACCATGCCCAACTAATTTTTGG + Intergenic
1013315683 6:108940445-108940467 CACCTGGTCCAACCAATCTTTGG - Intronic
1014291814 6:119566953-119566975 CACCTGGTCCAGCCAATCTCTGG + Intergenic
1015218320 6:130775836-130775858 CACCTGGTTGAACCAATGTTGGG - Intergenic
1015515587 6:134079764-134079786 CACCTGGTCCAACCATTCTGTGG + Intergenic
1017145438 6:151230347-151230369 TACCTGCTCCAAACAATTTCCGG + Intergenic
1017177264 6:151516760-151516782 CACCTGGTTGAACCAATCTCTGG - Intronic
1017399270 6:154040249-154040271 CACCGGCCCCAACCAAATTTGGG - Intronic
1017780593 6:157712434-157712456 CACCTGCTCCAACCAATCTTTGG + Intronic
1020006652 7:4786922-4786944 CACCATGTCCAGCTAATTTTTGG + Intronic
1020386911 7:7616532-7616554 CACCATGCCCAACTAATTTTTGG - Intergenic
1020521234 7:9189854-9189876 CACTTGGTCGAACCAATTTGTGG - Intergenic
1020990941 7:15195433-15195455 CACCTGGTCCAACCAATCTTTGG - Intergenic
1021101334 7:16587986-16588008 CACCTGGTCCAACCAATCTGTGG - Intergenic
1021610774 7:22455991-22456013 CACCAGGCCCAGCTAATTTTTGG - Intronic
1022215753 7:28259363-28259385 CACCTGGTCCAACCAGTCTTTGG - Intergenic
1022304834 7:29137367-29137389 CACCTGGTCCAGCCAATCTGTGG - Intronic
1022974534 7:35545299-35545321 CACCTGGTCCAATTAATCTTTGG + Intergenic
1023345222 7:39264898-39264920 CAGTTTTTCCAACCAATTTTGGG - Intronic
1023802032 7:43843524-43843546 CCCCTGGTCCAACTGATCTTTGG + Intergenic
1023964830 7:44957935-44957957 CACCGTGTCCAGCCAAGTTTTGG - Intergenic
1024360614 7:48463680-48463702 CTCCTGATCCAACCAGCTTTTGG - Intronic
1024752091 7:52478461-52478483 CACCTGGTTCAACCAATCTTTGG - Intergenic
1024770168 7:52713151-52713173 CACCTGGTGCAACCAATCCCTGG + Intergenic
1024770485 7:52715852-52715874 CACCTGGTCCAACCAATCTGTGG - Intergenic
1024924262 7:54596524-54596546 CACCTGATCAAACCAATCTGTGG + Intergenic
1025153717 7:56584480-56584502 CACCTGGCCCAACCAATCTTTGG + Intergenic
1025763574 7:64418379-64418401 CACCTGGCTCAACCAATATTTGG - Intergenic
1025772538 7:64526947-64526969 CACCTTGCCCTGCCAATTTTTGG - Intronic
1026131151 7:67621970-67621992 CATCTGGTCCAAACAATCTTTGG + Intergenic
1026183302 7:68061186-68061208 CACCTGGTCCAACCAATCTTTGG - Intergenic
1026214723 7:68338211-68338233 CACCTGGTCCAACCAATCTTTGG - Intergenic
1026220507 7:68392404-68392426 CACCTGGTCCAAATAATCTGTGG - Intergenic
1026222415 7:68412017-68412039 CACCTGGTCCAACCAATCTGTGG + Intergenic
1026274236 7:68862893-68862915 CACCTGGCCCAACCAATCTGTGG - Intergenic
1026494885 7:70893534-70893556 CACCTGGTCCAACCAATCTGTGG - Intergenic
1026594145 7:71720162-71720184 CACCTGGCCGAACCAATATGTGG + Intergenic
1026624887 7:71983050-71983072 CACCTGGTCCAACCAATCTGTGG + Intronic
1026921974 7:74162447-74162469 CACCTGGTCCAATCAACCTTTGG - Intergenic
1027959853 7:84931231-84931253 CACCACGTCCAGCTAATTTTTGG + Intergenic
1028469362 7:91187776-91187798 CACTTGGTCGAACCAATCTGTGG - Intronic
1028679188 7:93505955-93505977 CACCTGGTCCAACCAATCTTTGG + Intronic
1030164962 7:106544819-106544841 CACCTGGTACAACCAATCTTTGG - Intergenic
1030204461 7:106939448-106939470 CACCAGGCCCAGCTAATTTTTGG + Intergenic
1030369833 7:108686383-108686405 CTCCTGCTCCAACCAACTGTGGG + Intergenic
1031757220 7:125660222-125660244 CACCTGGTCGAACCAATCTGTGG + Intergenic
1031809482 7:126347824-126347846 CACCTGGTCAAAGCAGTTCTGGG + Intergenic
1031913290 7:127539862-127539884 CACCTGGTCCAACCAATCTGTGG + Intergenic
1034114567 7:148572285-148572307 CACCTGGTTGAACCAATCTGGGG + Intergenic
1034160447 7:148990604-148990626 CACCTGGTCCAACCCATCTTTGG + Intergenic
1034180353 7:149132615-149132637 CACCTGGTCCAACCCATCTCTGG - Intronic
1036175162 8:6530800-6530822 GACCTCATCCAACCATTTTTAGG + Intronic
1036390596 8:8321236-8321258 CACCATGTCCAACTAATTTTTGG + Intronic
1036450816 8:8865745-8865767 CACTTAGTCCAACTATTTTTGGG + Intronic
1037221559 8:16528785-16528807 TGCCTGGTCCAACCAATCTGTGG - Intronic
1037694164 8:21209039-21209061 CACCTGGTCCAAACAATCTTTGG + Intergenic
1037940991 8:22950708-22950730 CAACTGGTCCAACCAATCTGTGG - Intronic
1038473122 8:27842278-27842300 CACCTGGTCCAACCAATCTTGGG + Intergenic
1039300837 8:36206998-36207020 CACCATGCCCAACTAATTTTTGG + Intergenic
1039460733 8:37741943-37741965 CACCTGGTCAAATCAATATAGGG - Intronic
1039648028 8:39308182-39308204 CACCTGGTCCAACCAATCTTTGG + Intergenic
1041182232 8:55260686-55260708 CACCTGGTCCAACCAATCTTTGG - Intronic
1041597763 8:59677065-59677087 CACCTGGTCCAAACAGTCTTTGG + Intergenic
1041601093 8:59718037-59718059 CACCTGGTCTAACCAATCTTTGG + Intergenic
1041939010 8:63366357-63366379 CACCTGGTCCAACCAATATTTGG - Intergenic
1042397641 8:68310822-68310844 CACCTGGTCCAACCAATCTCTGG - Intronic
1042411648 8:68473312-68473334 CACCTGGTCCAACCAGTCTTTGG - Intronic
1042665163 8:71196201-71196223 CAGCTGGTCCAACCAATCTGTGG + Intergenic
1042949108 8:74182627-74182649 CACCTGGTCCAAACAATCTTTGG - Intergenic
1042982221 8:74542330-74542352 CACCACATCCAACTAATTTTTGG - Intergenic
1043532729 8:81168697-81168719 CACCACATCCAGCCAATTTTTGG - Intergenic
1044301648 8:90591292-90591314 CACCTGGTCCAACCAATCTATGG + Intergenic
1044656902 8:94557804-94557826 CACCCGGTCCAACCAATCTGTGG - Intergenic
1044945299 8:97383676-97383698 CACCTGGTCCAATCAATCTGTGG - Intergenic
1046367502 8:113254529-113254551 CACATGGTCCAACAAATCTTTGG + Intronic
1047238789 8:123066206-123066228 CACCTGGTCCAACCAATCTGTGG - Intronic
1052957800 9:34268315-34268337 CACCATGCCCAACTAATTTTTGG + Intronic
1055463617 9:76542518-76542540 AACCTGCTCTAACCAATCTTTGG + Intergenic
1055567831 9:77586693-77586715 CACCTGGTCCAACCAATTTTTGG - Intronic
1056626039 9:88254145-88254167 CATCTGGTCCCACCAGTGTTTGG + Intergenic
1057918265 9:99074279-99074301 CATCTGGTCAAACCAATCTGTGG + Intergenic
1058049964 9:100395558-100395580 CACCTGGTCTAACCAATCTGTGG - Intergenic
1185689888 X:2145575-2145597 CACCACGTCCAGCTAATTTTTGG - Intergenic
1186353749 X:8768284-8768306 CACCTGGTCCAACCAATCTTTGG - Intergenic
1187056761 X:15748041-15748063 CACCTGGTCGAACCAATCTGTGG - Intronic
1188159013 X:26777767-26777789 CACCTGGTCCAACCAATCTTTGG - Intergenic
1188491264 X:30740902-30740924 CACCTGGTCCAACCAATCTGTGG + Intergenic
1188872289 X:35387844-35387866 CACCTGGACCCACCAATCTATGG + Intergenic
1189863701 X:45300790-45300812 CACATGGTCCAACCAATCTTTGG - Intergenic
1189953906 X:46259227-46259249 CACCTGGTCCAACCAATCTTTGG + Intergenic
1191179619 X:57546177-57546199 CACCAGATCAAACCAATCTTTGG + Intergenic
1191609742 X:63100156-63100178 CACCTGGTCCAACCAATTTTGGG - Intergenic
1196030278 X:111089393-111089415 ACACTGGTACAACCAATTTTGGG - Intronic
1196380046 X:115079228-115079250 CACCTGGTGCAAACAATAGTTGG + Intergenic
1200812464 Y:7500164-7500186 CACCTGGACCCACCAATTGAGGG - Intergenic
1201497192 Y:14601253-14601275 CACCTCGCCCACCTAATTTTTGG + Intronic