ID: 1191609743

View in Genome Browser
Species Human (GRCh38)
Location X:63100157-63100179
Sequence ACACCTGGTCCAACCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191609743_1191609745 -2 Left 1191609743 X:63100157-63100179 CCAAAATTGGTTGGACCAGGTGT No data
Right 1191609745 X:63100178-63100200 GTGATGTTTACATAACACACAGG No data
1191609743_1191609747 3 Left 1191609743 X:63100157-63100179 CCAAAATTGGTTGGACCAGGTGT No data
Right 1191609747 X:63100183-63100205 GTTTACATAACACACAGGGAAGG No data
1191609743_1191609748 6 Left 1191609743 X:63100157-63100179 CCAAAATTGGTTGGACCAGGTGT No data
Right 1191609748 X:63100186-63100208 TACATAACACACAGGGAAGGTGG No data
1191609743_1191609746 -1 Left 1191609743 X:63100157-63100179 CCAAAATTGGTTGGACCAGGTGT No data
Right 1191609746 X:63100179-63100201 TGATGTTTACATAACACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191609743 Original CRISPR ACACCTGGTCCAACCAATTT TGG (reversed) Intergenic
No off target data available for this crispr