ID: 1191609745

View in Genome Browser
Species Human (GRCh38)
Location X:63100178-63100200
Sequence GTGATGTTTACATAACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191609743_1191609745 -2 Left 1191609743 X:63100157-63100179 CCAAAATTGGTTGGACCAGGTGT No data
Right 1191609745 X:63100178-63100200 GTGATGTTTACATAACACACAGG No data
1191609742_1191609745 -1 Left 1191609742 X:63100156-63100178 CCCAAAATTGGTTGGACCAGGTG 0: 3
1: 54
2: 81
3: 81
4: 177
Right 1191609745 X:63100178-63100200 GTGATGTTTACATAACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191609745 Original CRISPR GTGATGTTTACATAACACAC AGG Intergenic
No off target data available for this crispr