ID: 1191614880

View in Genome Browser
Species Human (GRCh38)
Location X:63159486-63159508
Sequence TGCTTCTACTTACTCCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191614880_1191614883 22 Left 1191614880 X:63159486-63159508 CCTGAGAGGAGTAAGTAGAAGCA No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191614880 Original CRISPR TGCTTCTACTTACTCCTCTC AGG (reversed) Intergenic
No off target data available for this crispr