ID: 1191614882

View in Genome Browser
Species Human (GRCh38)
Location X:63159515-63159537
Sequence AGATGTGCTTATTGCTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191614882_1191614885 21 Left 1191614882 X:63159515-63159537 CCTCAACAGCAATAAGCACATCT No data
Right 1191614885 X:63159559-63159581 ATTTACTGTTATCTACTCAATGG No data
1191614882_1191614883 -7 Left 1191614882 X:63159515-63159537 CCTCAACAGCAATAAGCACATCT No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191614882 Original CRISPR AGATGTGCTTATTGCTGTTG AGG (reversed) Intergenic
No off target data available for this crispr