ID: 1191614883

View in Genome Browser
Species Human (GRCh38)
Location X:63159531-63159553
Sequence CACATCTAGCACAAAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191614882_1191614883 -7 Left 1191614882 X:63159515-63159537 CCTCAACAGCAATAAGCACATCT No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data
1191614877_1191614883 25 Left 1191614877 X:63159483-63159505 CCCCCTGAGAGGAGTAAGTAGAA No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data
1191614879_1191614883 23 Left 1191614879 X:63159485-63159507 CCCTGAGAGGAGTAAGTAGAAGC No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data
1191614880_1191614883 22 Left 1191614880 X:63159486-63159508 CCTGAGAGGAGTAAGTAGAAGCA No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data
1191614878_1191614883 24 Left 1191614878 X:63159484-63159506 CCCCTGAGAGGAGTAAGTAGAAG No data
Right 1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191614883 Original CRISPR CACATCTAGCACAAAGATCT TGG Intergenic
No off target data available for this crispr