ID: 1191616779

View in Genome Browser
Species Human (GRCh38)
Location X:63177628-63177650
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 15, 1: 78, 2: 144, 3: 215, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191616779_1191616786 15 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616786 X:63177666-63177688 GAGAGCAGGCCTTGAGTGGCAGG No data
1191616779_1191616781 -7 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616781 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
1191616779_1191616784 1 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616784 X:63177652-63177674 GACAAAAGAATCTGGAGAGCAGG No data
1191616779_1191616788 27 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616788 X:63177678-63177700 TGAGTGGCAGGTCCTTCCACTGG No data
1191616779_1191616785 11 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616779_1191616789 30 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616789 X:63177681-63177703 GTGGCAGGTCCTTCCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191616779 Original CRISPR CATGGGGTGTTCCCTTGATG TGG (reversed) Intergenic
900374845 1:2349015-2349037 CATGGGGTGTCCCTGTGCTGAGG - Intronic
900699433 1:4034914-4034936 CACGGGGTGCTCCCTTGAGGTGG - Intergenic
902969518 1:20037238-20037260 CATGGGGTGATCCCTTGATGTGG + Intronic
905411036 1:37768081-37768103 CATGGGGAGGACACTTGATGAGG + Intergenic
905792750 1:40798988-40799010 CATGGGGTGGGCCCTGGCTGGGG + Intronic
906914747 1:49996020-49996042 CATAGGGTGCTCCTTTGATGTGG - Intronic
907633446 1:56107552-56107574 CATGGGGTGATCCCTTGATGTGG - Intergenic
907887299 1:58605438-58605460 CATGGGATGATCCCTTGATATGG + Intergenic
908040561 1:60107963-60107985 CCTGGGGTGCTCCCTTAATTCGG + Intergenic
908883492 1:68759731-68759753 CACAGGGTGATCCCTTGATGTGG - Intergenic
908891837 1:68857925-68857947 CTCAGGGTGCTCCCTTGATGCGG + Intergenic
909405765 1:75287630-75287652 CACAGGGTGCTTCCTTGATGTGG + Intronic
909712903 1:78672849-78672871 CACAGGGTGTTCTCTTAATGTGG + Intergenic
909828253 1:80153652-80153674 AACGGGGTTCTCCCTTGATGTGG + Intergenic
910232822 1:85003737-85003759 CATGGGGTGATCCCTTGATGTGG - Intronic
910323569 1:85977179-85977201 CATGGGGTGATCCCTTGATGTGG - Intronic
910919487 1:92328827-92328849 CACAGGGTGCTCCCTTGATTTGG + Intronic
911323254 1:96440033-96440055 CATGGGGTGTTCCGTTGATGTGG + Intergenic
911562127 1:99418546-99418568 CACAAGGTGCTCCCTTGATGTGG - Intergenic
912028254 1:105205771-105205793 CATGGGGTGTTCTTTTGATAGGG - Intergenic
912612360 1:111061561-111061583 CATAGGGTGATCACTTGATGTGG + Intergenic
913036440 1:114970593-114970615 CATGGGGTGATCCCTTGATGTGG + Intronic
913155347 1:116091999-116092021 CATGGGGTATTTCCTTGATGTGG + Intergenic
914704106 1:150157458-150157480 CATTAGGTGTCCCCTTGTTGGGG - Exonic
915055494 1:153124898-153124920 CATGGGGTGCTGCCTTGATTTGG - Intergenic
915669520 1:157477107-157477129 CACAGGGTGCTCCCTTGATGTGG + Intergenic
915821604 1:159030480-159030502 CACAGGGTGCTCCCTTGATGTGG + Intronic
915999834 1:160605354-160605376 CACAGGGTGATCCTTTGATGTGG + Intergenic
916681654 1:167110181-167110203 CATGTGGTGTTCTCTTGATGTGG - Intronic
916868709 1:168888479-168888501 CACAGGGTATTCCCTTGCTGTGG - Intergenic
917913557 1:179677535-179677557 CACGGGATGCTCCCTTGATGTGG + Intronic
918171864 1:182004851-182004873 CATGGGGTGCTTCCTTGATGTGG - Intergenic
918819658 1:189236578-189236600 CATGGGGTGCTCCCTTAATGTGG + Intergenic
918972224 1:191433878-191433900 CACGGGGTGATCCCTTGATGTGG - Intergenic
919407941 1:197208404-197208426 CATGGAGTGCTCCCTTATTGTGG + Intergenic
919491768 1:198213230-198213252 CACAGGGTGCTCCCTTAATGTGG - Intronic
919777920 1:201206213-201206235 CAGGGGGGGCTCCCTTGAAGGGG + Exonic
922000096 1:221468536-221468558 CACACGGTGTTCCCTTGATGTGG + Intergenic
922910139 1:229208920-229208942 CATGTTGTGTTCCCTTGGGGAGG - Intergenic
923122353 1:231003416-231003438 CATGGGGTCATCCCTTGATGTGG - Intergenic
923174140 1:231446646-231446668 CATGGGGTGATCCCTTGATGTGG - Intergenic
924193268 1:241578384-241578406 CATGGCATGTTTCATTGATGTGG + Intronic
924691575 1:246356252-246356274 CAAGGGGTTCTCCCTTGATGTGG - Intronic
924767995 1:247052273-247052295 CACAGGGTGATGCCTTGATGTGG + Intronic
924880087 1:248151954-248151976 CACTGTGTGTTCCCTTGAGGTGG + Intergenic
924894302 1:248318564-248318586 CACTGGGTGCTCCCTTGATGTGG - Intergenic
924909542 1:248496308-248496330 CATGGGGTGCTCCCTTGATGTGG + Intergenic
924914560 1:248551752-248551774 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1063561204 10:7130007-7130029 CACGAGGTGCTCCCTTGATGTGG + Intergenic
1065355331 10:24834973-24834995 CATGCGGTGTTGCTTTGATGTGG - Intergenic
1065462432 10:25982751-25982773 CACAGGGTGCTCCCTTGATATGG - Intronic
1065604201 10:27399520-27399542 CTTAGGGTGTTTCCATGATGAGG + Intronic
1065894495 10:30151607-30151629 CATGAGGTGCTCCCTTGATGTGG + Intergenic
1066022508 10:31318634-31318656 CCCGGGGAGTTCCCTTGATGAGG - Intronic
1067034686 10:42904200-42904222 CACAGGGTTCTCCCTTGATGTGG - Intergenic
1067234116 10:44434262-44434284 CATGGGGTGCTCCTTGGATGTGG + Intergenic
1068161588 10:53271911-53271933 CCTGGGGTGATTCCTTGATGTGG - Intergenic
1068532905 10:58209432-58209454 CACAGGGTGATCCTTTGATGTGG + Intronic
1068808616 10:61228699-61228721 CGTAAGGTGCTCCCTTGATGTGG - Intergenic
1069129494 10:64681607-64681629 CATAGGGTGCTCCCTTGATGTGG + Intergenic
1069275529 10:66586862-66586884 CATGGGATGCTCCCTTAATGTGG + Intronic
1069303544 10:66939045-66939067 CGTAGGGTGTTCCCTTGGTGTGG - Intronic
1069648213 10:70020146-70020168 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1070224492 10:74486820-74486842 CACATGCTGTTCCCTTGATGAGG + Intronic
1071761374 10:88611222-88611244 CATGGGGTGCTCCCTTGGTGTGG - Intergenic
1071880958 10:89897894-89897916 CACAGGGTGCTTCCTTGATGCGG + Intergenic
1072151261 10:92686572-92686594 TGAGGGGTGTTGCCTTGATGTGG - Intergenic
1072769174 10:98123507-98123529 TATGGGGTGCTCCCTTGATGTGG + Intergenic
1072871746 10:99126954-99126976 CATGGTGTGATCCCTTCATGTGG - Intronic
1072899835 10:99397376-99397398 CAAGGGATGTTCTCTTCATGTGG + Exonic
1074037289 10:109753357-109753379 CATGGGGTAATCCCTTGATGTGG + Intergenic
1074466879 10:113691538-113691560 CATGGGTTACTCCTTTGATGTGG + Intronic
1074492919 10:113955213-113955235 GAGGGGGAGTTCCCTTGATGGGG + Intergenic
1074807940 10:117072671-117072693 CATGGGGTGTTCCCCTGATGTGG - Intronic
1074877013 10:117621603-117621625 AAGGGGATGTTCCCTTGAGGCGG - Intergenic
1074986174 10:118662094-118662116 CACAGGGTGCTCACTTGATGTGG + Intergenic
1077270127 11:1672927-1672949 CATGGGCTGCTCCCTCCATGTGG + Intergenic
1077827924 11:5830988-5831010 CATGGGGTGCTCCTTTCATGTGG + Intronic
1078588080 11:12611159-12611181 CATGGGGTGATCACTTGATGTGG - Intergenic
1078626808 11:12965348-12965370 CAGGGGGTCTTCCCTGCATGGGG + Intergenic
1078687755 11:13549025-13549047 CATGAGGTTATCCCTTGATGTGG + Intergenic
1079271024 11:18986349-18986371 CATGGGGTGATCCCTTGAAGTGG + Intergenic
1079464084 11:20712659-20712681 CATGGGGTGATCCCTTGATGTGG + Intronic
1079627594 11:22634562-22634584 CACGGGGTGCTCCCTTGATGTGG + Intronic
1079763172 11:24356504-24356526 CACAGGGTGCTCCTTTGATGTGG + Intergenic
1079791638 11:24747229-24747251 CATGGGGTATTCCCTTGATGTGG + Intronic
1079806002 11:24931940-24931962 CATGGGGTTCTCCATTAATGTGG + Intronic
1080580916 11:33643116-33643138 CATGGGGAGTTCCCTTTAATTGG - Intronic
1080585797 11:33682009-33682031 CATGGGGTGTTCCCTTGATGTGG + Intergenic
1080864002 11:36177500-36177522 CACAGGGTGGTCCCTTGATGTGG + Intronic
1080923465 11:36731627-36731649 CACAGGGTGATCCCTTGATGTGG - Intergenic
1081091034 11:38866908-38866930 CACAGAGTGCTCCCTTGATGTGG + Intergenic
1081326668 11:41753982-41754004 CATGGGATGCTCCCTTGGTGTGG + Intergenic
1082104028 11:48200340-48200362 CATGGGGTGCTCCCTTGATATGG - Intergenic
1082670235 11:56026573-56026595 CATGGGTTGTGTCCTTTATGTGG - Intergenic
1082723382 11:56706214-56706236 CATGGGGTACTCTCTTGATGTGG - Intergenic
1085240546 11:75050556-75050578 CACCGGGTGCTCCCTTGATGTGG + Intergenic
1086315596 11:85588852-85588874 CATGGGGTGGTCCCTTGATGTGG + Intronic
1086813273 11:91336467-91336489 TATAGGGTGTTCTCTTGATGTGG - Intergenic
1086844445 11:91730867-91730889 CATGGTGTGCTCCCTTGATGTGG - Intergenic
1086864283 11:91960565-91960587 CATGAGGTGCTCCCTTGATGTGG - Intergenic
1086877342 11:92112392-92112414 CATGGAGTGCTTCATTGATGTGG - Intergenic
1086997809 11:93378758-93378780 CATGGGGTGCTCCCTTGATGTGG + Intronic
1087206688 11:95404034-95404056 CATGGGGTACTCCCTAGATGTGG + Intergenic
1087308092 11:96507294-96507316 CATAAGATGTTCCCATGATGAGG - Intronic
1087602154 11:100329783-100329805 TATGGGGTGCTCCCTTGATGTGG - Intronic
1087630891 11:100648758-100648780 CATGGGTTGCTCCCTTGATATGG - Intergenic
1087804415 11:102539816-102539838 CACGGGGTGCTCCCTTGATGTGG - Intergenic
1088372372 11:109106119-109106141 CATGGAGTGCTCCCTTTATGTGG + Intergenic
1088387401 11:109275132-109275154 CATGGGGTGCTCCCTTGATGTGG + Intergenic
1088800128 11:113297633-113297655 CATGGGGTGATGCCTTGATGTGG - Intergenic
1088951247 11:114572176-114572198 CACAGGGTGCTCCCTTGATGTGG - Intronic
1089837045 11:121379682-121379704 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1090688313 11:129149594-129149616 CATGGGGTGATCCCTTGATGTGG - Intronic
1090756801 11:129798747-129798769 CATGGTGTGATCCTTAGATGTGG - Intergenic
1092604348 12:10102209-10102231 CACAGGGTGTTCCCTTGATGTGG - Intronic
1093594617 12:20945753-20945775 CATGGATTGCTTCCTTGATGTGG - Intergenic
1093599250 12:21001925-21001947 CACGGGGTGTTCCCTTGATGTGG + Intergenic
1093604413 12:21073231-21073253 CATAGGGTGCTCCTTTGATGTGG + Intronic
1093963840 12:25303985-25304007 CATGGCATGCTTCCTTGATGTGG - Intergenic
1095176378 12:39096415-39096437 ACGGGGGTGTTCCCTTGATGTGG - Intergenic
1095178628 12:39122235-39122257 CACAGGGGGCTCCCTTGATGTGG + Intergenic
1095225901 12:39675906-39675928 CACAGGGTGATCCTTTGATGTGG - Intronic
1095725495 12:45447043-45447065 CATGGGGTGATCCCTTGATGTGG - Intergenic
1096242969 12:49969144-49969166 CACGGGGGGTTCCCTGGCTGGGG - Intronic
1097302434 12:58033568-58033590 CATGGGGTGATCCCTTGATGTGG + Intergenic
1097603912 12:61729906-61729928 CATGGGGTGATCCCTCGATGTGG + Intronic
1097907043 12:64931293-64931315 CACGGGGTGTTCCCTTGATGTGG + Intergenic
1098520599 12:71431555-71431577 CACTGGGTATTCCCTTGATGTGG - Intronic
1099042075 12:77668097-77668119 CATGGGATGCTCCCTTGATGTGG - Intergenic
1099163625 12:79275105-79275127 TGTGGGGTGCTCCCTTGGTGTGG - Intronic
1099803535 12:87488175-87488197 CACAGGGTGTTTCCTTGATGTGG + Intergenic
1100421265 12:94436039-94436061 CACAGGGTGATTCCTTGATGTGG - Intronic
1100464285 12:94831685-94831707 CATGGGGCTTACCCTTCATGAGG + Intergenic
1100669431 12:96794922-96794944 CATGGGGTGCTCCGTTGATGTGG + Intronic
1100918634 12:99456228-99456250 AATGGGGTGCTCTCTTGATATGG - Intronic
1100921054 12:99487168-99487190 CACAGGGTATTCCCTTGATTTGG + Intronic
1100937136 12:99681646-99681668 CACAGGGTGCTCTCTTGATGTGG - Intronic
1100951356 12:99853542-99853564 CACAGGGTGCTCCCTTGATGTGG - Intronic
1101544342 12:105697632-105697654 CACAGGGTAATCCCTTGATGTGG + Intergenic
1102605993 12:114067621-114067643 CATGGGTTTTTAGCTTGATGTGG - Intergenic
1105314296 13:19243144-19243166 CACAGGGTGATCCTTTGATGTGG - Intergenic
1105545482 13:21347844-21347866 GATGGGGAGTCCCCTTAATGGGG - Intergenic
1105990342 13:25614685-25614707 CATGGGGTGTTCTCTTGATGTGG + Intronic
1106392156 13:29345837-29345859 CACAGGGTGCTCCCTTGATGTGG + Intronic
1106432983 13:29699248-29699270 CACAGGTTGCTCCCTTGATGTGG - Intergenic
1107253199 13:38391460-38391482 CATGGGGTAATCCTTTGATGTGG + Intergenic
1107426731 13:40301538-40301560 CAGGGGGTGCTCCCTTGATGTGG + Intergenic
1107430729 13:40338125-40338147 CATGGGACATTCCCTGGATGTGG - Intergenic
1107701953 13:43057782-43057804 CATGGGGTGATCCTTTGATGTGG + Intronic
1108134306 13:47338737-47338759 AGTGGGGTGCTCCATTGATGTGG - Intergenic
1108486331 13:50930074-50930096 CTTGTGGTGTTCCCTTAATTTGG + Intronic
1108818813 13:54321109-54321131 CACGGGGTGCTCCCTTGCTGTGG - Intergenic
1108831750 13:54487552-54487574 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1109150721 13:58844006-58844028 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1109547533 13:63847601-63847623 CATGGAATGTTCCTTTGATGTGG + Intergenic
1109877023 13:68418083-68418105 GATGTGGGGTTACCTTGATGTGG + Intergenic
1109945364 13:69424583-69424605 CATGGGGTGCTCCCTGGATATGG - Intergenic
1110375888 13:74793782-74793804 CATGAGATGCTCCCTTGATGTGG + Intergenic
1112068897 13:95825856-95825878 CACAGGTTGCTCCCTTGATGTGG + Intronic
1114617433 14:24075774-24075796 GATGGGGTGGTCCTTTGAGGAGG - Intronic
1114694225 14:24611905-24611927 CATGGGGTGATCCTTTGATGTGG + Intergenic
1114697926 14:24644752-24644774 CACAGGGTGCTCCCTTCATGTGG - Intergenic
1114756735 14:25268670-25268692 CATGGGGTGATCCCTTGATGTGG + Intergenic
1114760568 14:25309159-25309181 CATGGGGTGATCCCTTGATTTGG - Intergenic
1115393129 14:32876856-32876878 CAAAGGGTGCTCCCTTGGTGTGG + Intergenic
1116324512 14:43515026-43515048 CATGGGGTGATCCTGGGATGTGG - Intergenic
1116406184 14:44568636-44568658 TATGGAGTGATCCCTTGATATGG - Intergenic
1116668943 14:47816886-47816908 CAAAGGGTGATCCCTTGATGTGG + Intergenic
1117193344 14:53315912-53315934 CAAGGGGTGATCCCTTGATGTGG + Intergenic
1117240799 14:53830163-53830185 CATGACGTGATCCCTTGATGGGG - Intergenic
1117615068 14:57526670-57526692 CATGGGGTGATCCCTTTATGTGG + Intergenic
1117969785 14:61240447-61240469 CATGTGGTGTTACCTGGAGGTGG + Intronic
1117983105 14:61361266-61361288 CATGCGGTGTCCCCTTACTGAGG + Intronic
1120400243 14:84022462-84022484 CAGGAGGTACTCCCTTGATGTGG + Intergenic
1120605361 14:86569918-86569940 CATGAGGTGATCGCTTGATATGG + Intergenic
1121848354 14:97195920-97195942 CACGGGGTGCTCCCTTGATGTGG + Intergenic
1123191382 14:106575563-106575585 CATGAGGTGTTCCCTCAATGTGG + Intergenic
1123220246 14:106849105-106849127 CACAGGGTGTTCCCTCAATGTGG + Intergenic
1124006656 15:25800338-25800360 CTTGGGGTGTTCAGTTGGTGTGG - Intronic
1124387008 15:29217930-29217952 CATGGGGTGTTCCCTTGGTGTGG + Intronic
1124505113 15:30265554-30265576 CACAGGGTGCTCCCTTTATGTGG - Intergenic
1124738439 15:32273081-32273103 CACAGGGTGCTCCCTTTATGTGG + Intergenic
1125383266 15:39110281-39110303 CGTGAGGTGCTTCCTTGATGAGG - Intergenic
1126184735 15:45821158-45821180 CACGCGGTGCTCCCTTGATGTGG + Intergenic
1126190339 15:45871950-45871972 CACAAGGTGTTCCCTTGATGTGG - Intergenic
1126465530 15:48958219-48958241 CATGGGCTGGTCCTATGATGAGG + Intronic
1126977396 15:54198668-54198690 CACGGAGTGCTCCCTTGATGTGG - Intronic
1126997328 15:54460080-54460102 CATTGGGTGATCCCTTGATATGG + Intronic
1127014565 15:54669026-54669048 CGTGGGGTGCTTCCTTGATGTGG - Intergenic
1127090097 15:55457996-55458018 CCATGGGTGTTCCCTTGATGTGG - Intronic
1127573974 15:60272478-60272500 CACAGGGTGCTCCGTTGATGTGG + Intergenic
1129631762 15:77267670-77267692 CACGGGTTGCTCCCTTCATGTGG - Intronic
1130604972 15:85307578-85307600 CACAGGGTGTTCCCTTGATGGGG - Intergenic
1131413752 15:92233211-92233233 CATGAGGCATTCCCTTCATGTGG - Intergenic
1133641959 16:7725665-7725687 CATGGGGTGATCCCTTGATGTGG + Intergenic
1133844528 16:9441569-9441591 CATGGGGGGGACCCTTGCTGTGG - Intergenic
1135883145 16:26279107-26279129 CAAAGGGTGTTCCCTTGATGTGG + Intergenic
1135901677 16:26465384-26465406 CACGTGTTGTTCCTTTGATGAGG - Intergenic
1137338165 16:47571884-47571906 CAAGGGGTGTTCCCTTTGTGTGG + Intronic
1138653704 16:58477451-58477473 CATTGGGAGTTCCCTTAAGGTGG - Intronic
1139041583 16:63005099-63005121 CATGGGGTACTCCCTTGATGTGG + Intergenic
1140404592 16:74700425-74700447 CATGGGGTCTTCCCAGGAGGCGG - Intronic
1142940342 17:3375781-3375803 CATGGGGTGATCCCTTGATATGG + Intergenic
1143434765 17:6915213-6915235 CACAGGGTCTTCCCTTGATGGGG - Intronic
1144278269 17:13698699-13698721 CATGGGGTACTCCCTTGATGTGG + Intergenic
1144495464 17:15742458-15742480 CCTCCGGTGTTTCCTTGATGGGG + Exonic
1146460287 17:33040869-33040891 CCTGGGCTGTTACCTTGTTGGGG + Intronic
1146613032 17:34325337-34325359 CACGGAGTGTTCCCTTGATTTGG + Intergenic
1147922876 17:43929123-43929145 GATGAGATGTTCCCATGATGAGG + Intergenic
1150135254 17:62691905-62691927 CATGGCGTTTTCCCTTTCTGGGG + Intronic
1150528746 17:65954321-65954343 TATGGGGTGCTCCCTTGATGTGG - Intronic
1151078899 17:71305258-71305280 TATGGGGTGCTCCTTTGATGTGG - Intergenic
1153071827 18:1115379-1115401 TACGAGGTGCTCCCTTGATGTGG + Intergenic
1153451270 18:5232385-5232407 CATGAAGTGCTCCCTTGATGTGG + Intergenic
1153556183 18:6316350-6316372 TATGGGGTGTTCCCTTGATGTGG - Intronic
1153969288 18:10210642-10210664 CTTAGGGTGGTCCCTTGAAGTGG + Intergenic
1155886826 18:31218063-31218085 CACAGGGTGATCCCTTGATGTGG - Intergenic
1156326760 18:36080405-36080427 CGCAGGGTGGTCCCTTGATGTGG - Intergenic
1156344667 18:36246307-36246329 CCAGGGGTGCTCCCTTGATGTGG + Intronic
1157507604 18:48239676-48239698 CACAGAGTGATCCCTTGATGTGG - Intronic
1163194208 19:15703163-15703185 CATGGTGTGCTCCATTGATACGG - Intergenic
1163799359 19:19355502-19355524 CCTCAGGTGATCCCTTGATGGGG + Intronic
1166737742 19:45096172-45096194 CATGGGGTGGGGCCTGGATGTGG + Intronic
1167203933 19:48087122-48087144 CATGGGGTGTTCCCTTGATGTGG - Intronic
1168723663 19:58569317-58569339 CCTGGGGTGCTCCCTCCATGAGG + Exonic
925637912 2:5959889-5959911 CACAGGGTTCTCCCTTGATGTGG + Intergenic
925652235 2:6103804-6103826 CACAGGGTGCTCCCTTGGTGTGG + Intergenic
925785647 2:7429730-7429752 CACTCGGAGTTCCCTTGATGTGG - Intergenic
925795592 2:7539154-7539176 CACAGGGTGCTCCATTGATGTGG + Intergenic
926867075 2:17371946-17371968 CATTGGGTTATCCCTTGATGTGG + Intergenic
927036621 2:19184605-19184627 CACTGGATGCTCCCTTGATGTGG + Intergenic
927080041 2:19618033-19618055 CATGGGGTGCTCCCATGATGTGG - Intergenic
928356728 2:30622762-30622784 CATGGGGTGCTCCCTTGATGTGG - Intronic
928480145 2:31675253-31675275 CACAGGGTGTTCCCTTGATGTGG + Intergenic
928782984 2:34848024-34848046 CACAAGGTGTTCCCTTGATGTGG + Intergenic
929197137 2:39196477-39196499 CATGGGGTGCTTCCTTGATGTGG - Intronic
930423039 2:51177457-51177479 CATATGGTGCTTCCTTGATGTGG - Intergenic
930469672 2:51795981-51796003 AATGGGGTGCCCTCTTGATGTGG - Intergenic
930574216 2:53126758-53126780 CACTGGGGGATCCCTTGATGTGG + Intergenic
931535908 2:63276188-63276210 CATGGAGTGCTCCCTTGATGTGG - Intronic
931834721 2:66086249-66086271 CCGGGGGTGCTCCCTTGATGTGG - Intergenic
932925576 2:75969516-75969538 CATAGGGTGGTCCCTTGATGTGG - Intergenic
933131916 2:78682455-78682477 CATGGGGTGCTCTCCTGATATGG - Intergenic
933340995 2:81025873-81025895 CATGTGGTGATTTCTTGATGTGG + Intergenic
933349670 2:81137360-81137382 CATAAAGTGTTCCTTTGATGTGG - Intergenic
933407874 2:81885227-81885249 CATGGGATCTTCACTTGATGTGG - Intergenic
933433372 2:82214168-82214190 CACAGGGTGTTCCCTTGATGTGG + Intergenic
933474462 2:82771443-82771465 CATGAGGTGATTCCTTGATGTGG - Intergenic
934111308 2:88746444-88746466 AATGGGGTGATCCCTTGATGGGG + Intronic
935024999 2:99268509-99268531 CATGGGGTGATCCCTTGATGTGG + Intronic
935053382 2:99543749-99543771 CATGGTGAGTTCTCTTCATGTGG - Intergenic
935477344 2:103538500-103538522 CACGGGGTATTCCCTTGGTGTGG + Intergenic
935734606 2:106096889-106096911 TATGGGGTTTGCCTTTGATGTGG - Intronic
935949711 2:108317453-108317475 CATGAGGTGATCACTTGATGTGG - Intergenic
936088855 2:109488233-109488255 CATGGGGGGTTCCCTTGCATTGG + Intronic
936633801 2:114233532-114233554 CATGAGGTGATGCCTTGATGTGG + Intergenic
936776805 2:115984399-115984421 CATAGGATGTCCCCTTGATTTGG + Intergenic
936815520 2:116456160-116456182 CACGGTGTGTTCCCTTTTTGTGG + Intergenic
936857791 2:116980831-116980853 CATAGGGTGATCTCTTGGTGTGG - Intergenic
936879396 2:117232102-117232124 TGTGGGGTGTTCCCTTGATGTGG + Intergenic
936890200 2:117360270-117360292 CATGAGGTGTTCTTTTGATGTGG - Intergenic
936899210 2:117465607-117465629 CATGGGATGCTCCCTTTATGTGG + Intergenic
937052671 2:118905188-118905210 CCTGGGGTTTTGGCTTGATGTGG + Intergenic
937410535 2:121670784-121670806 CACAGGGTGATCCCGTGATGTGG - Intergenic
937699356 2:124846754-124846776 CATGGGGTTCTCCTTTGATGGGG + Intronic
937798879 2:126058744-126058766 CATGTGATTTTCCCTTGATGTGG + Intergenic
938216499 2:129522364-129522386 CTCGGGGTGCTCCCTTGATGTGG + Intergenic
938854781 2:135298502-135298524 CAGAGGGTGATCCCCTGATGTGG + Intronic
938900268 2:135793429-135793451 CACAGGGTGATCCCTTGATGTGG - Intronic
939245673 2:139620769-139620791 CATGGGGTTATCCCTTGATGTGG + Intergenic
939305234 2:140402175-140402197 CACGGGGTGTTCCCTTGATGTGG - Intronic
939744964 2:145957332-145957354 TAAGGGGTGATCCCTTGATGTGG + Intergenic
939919235 2:148087674-148087696 CATGGGGCAATCCCTTGATATGG - Intronic
940045841 2:149409089-149409111 CATGGGGTGCTCCCTTGATGTGG + Intronic
940630417 2:156230675-156230697 CATGTGGCAATCCCTTGATGTGG - Intergenic
940679058 2:156761269-156761291 CACAGGGTGCTCCCATGATGGGG - Intergenic
941060713 2:160843394-160843416 CATAAGGTGGTCCCTTGATGTGG - Intergenic
941738260 2:169004832-169004854 CATGGTGTGCTTCCTTGGTGTGG + Intronic
943149905 2:184099033-184099055 CACAGGGTGCTCCCTTGATGTGG + Intergenic
943762181 2:191622042-191622064 GATGGGGTGTTGGCTGGATGCGG + Intergenic
943772869 2:191737571-191737593 CTGGGGCTGTTCCCTTGGTGAGG + Intergenic
944072977 2:195694442-195694464 CACTGGGTGCTCCCTTGATATGG + Intronic
944263666 2:197701099-197701121 CATGGGGTGATCCCTTGATGTGG + Intronic
944602906 2:201321331-201321353 CACAGGGTGTTCTCTTGATGTGG - Intronic
945285687 2:208078972-208078994 CATAGGGTGCTCCCTTGCTGTGG - Intergenic
945521579 2:210833939-210833961 CATGAGGTGTTCCCCTGATGTGG + Intergenic
945657541 2:212643930-212643952 CTTGGGGTGCTCCCTTGATTTGG + Intergenic
945739161 2:213640429-213640451 CATTGGGTGCTCCCTTGATGTGG + Intronic
945783444 2:214204635-214204657 AAGAGGGTGCTCCCTTGATGTGG - Intronic
947348199 2:229215617-229215639 CATGGGGAGTTCCCATGAAAAGG + Intronic
947460607 2:230300609-230300631 CACAGGGTGATCCCTTAATGTGG - Intronic
947791470 2:232871664-232871686 CATGCGGTGTTCCCAGGATGGGG + Intronic
1168941224 20:1712850-1712872 CACAGGATGTTCCCTTGGTGTGG - Intergenic
1169908203 20:10624581-10624603 CATGGGGTGGTCCTTTGAAATGG + Exonic
1170086337 20:12536103-12536125 CATTGGGTGCTCCCTTTATGTGG - Intergenic
1170241667 20:14173801-14173823 CACAGGGTGCTCCCTTGATGTGG + Intronic
1170650839 20:18239528-18239550 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1170741141 20:19057401-19057423 CATGGGGTCCTCCCTTGATGTGG - Intergenic
1170906173 20:20516844-20516866 CATGGGGTGTTCCCTTGATGTGG - Intronic
1171198444 20:23222289-23222311 CATGGGGTGATCCCTTGATATGG + Intergenic
1171396810 20:24839835-24839857 CATGGTCAGTTCCCTTGAAGTGG - Intergenic
1172851349 20:37968605-37968627 CATGGGGTGCTCCCTTGATGTGG + Intergenic
1175514932 20:59563286-59563308 GATGGGGGCTTCCCCTGATGGGG - Intergenic
1177367036 21:20152294-20152316 CATGAGGTGTCCCCTTAATGTGG - Intergenic
1177578981 21:22994696-22994718 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1177884492 21:26732244-26732266 CATGGAATGCTCCCTTAATGTGG + Intergenic
1178018107 21:28375760-28375782 CACATGGTGTTCCCTTCATGTGG + Intergenic
1178038285 21:28609357-28609379 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1178732956 21:35121265-35121287 CATGGGGTGCTCCCTGAATGTGG - Intronic
1179059952 21:37970772-37970794 CCTGGGGTGTTTCCTTGGTCTGG + Intronic
1179443423 21:41412006-41412028 CACAGGGTGATCCTTTGATGTGG - Intergenic
1179467749 21:41589072-41589094 CATGGGGTGCTCCCTTGAGGTGG + Intergenic
1179610646 21:42547909-42547931 GATGGGCTGTTCCCGTGAGGTGG - Intronic
1180896417 22:19336847-19336869 CACAGGGTGATCCCTTGATTTGG - Intronic
949145947 3:700544-700566 CATGGGGTGACCCCTTGATGTGG + Intergenic
949189688 3:1236539-1236561 CATGGGGTGCTCCCTTGTTTCGG - Intronic
949377441 3:3405862-3405884 CATGGGGTGCTCCTTTGATGTGG - Intergenic
949749419 3:7333444-7333466 CATGGGGCGATCCCTCGATGTGG - Intronic
950587998 3:13909663-13909685 CTTTGCGTGTTCTCTTGATGTGG - Intergenic
950820259 3:15749679-15749701 CACTGGGTGTTCCCTTGATGTGG + Intronic
951153682 3:19323685-19323707 CACAGGATGCTCCCTTGATGTGG + Intronic
951260550 3:20503383-20503405 CTTGGAGTGATCCCTTCATGTGG + Intergenic
951294592 3:20918120-20918142 CACAGGGTGCTTCCTTGATGTGG - Intergenic
951325947 3:21301965-21301987 CATGGAGTGATCCCTTGATGTGG - Intergenic
951690921 3:25396042-25396064 CACAGGGTGATCCCTTGATGGGG + Intronic
951727205 3:25773800-25773822 CATGGGGTGCTCCCTTGATGTGG + Intronic
952082962 3:29782488-29782510 CACGGGATGCTCCCTTGATGTGG - Intronic
952183136 3:30940925-30940947 TATGGGGTGATCCTTTGATTTGG + Intergenic
952435446 3:33268816-33268838 CACAGGGTGATCCCTTGATGTGG + Intergenic
952714828 3:36470249-36470271 CACGGGGTGCTCCCTTGATGTGG + Intronic
952732558 3:36653880-36653902 CACAGGGTGCTCCCTTGATGTGG - Intergenic
952993701 3:38856021-38856043 CACAGGGTGATCCCCTGATGTGG - Intronic
953103644 3:39854823-39854845 CATAGGGTGATCTCTTGATGTGG + Intronic
953185373 3:40632281-40632303 CATGAGGTTTTCCCTTGATAAGG - Intergenic
953195684 3:40731204-40731226 CATGGGGTGGTCCCTTGATGTGG + Intergenic
953382299 3:42481079-42481101 CATGGGGTGATCTCTTGATGTGG - Intergenic
957281400 3:78155163-78155185 CCCAGGGTGTTCCCTTGATGGGG - Intergenic
957677934 3:83394102-83394124 AGTGGGATGTTCCCTTGATGTGG - Intergenic
957776321 3:84760323-84760345 CACTGGGTGATCCCTTGATGTGG - Intergenic
958064441 3:88525503-88525525 CACAGGGTGCTCCTTTGATGTGG + Intergenic
958151917 3:89702620-89702642 CCTGGGGTATTCCCTTGATGTGG - Intergenic
958171856 3:89948321-89948343 CAAGGGGTGTTCCCTTGATGTGG - Intergenic
958530902 3:95329399-95329421 CATAGAGTGTTCACTAGATGTGG + Intergenic
958768236 3:98396165-98396187 CATGGGGTGTTCCATTGATGAGG - Intergenic
958787328 3:98612555-98612577 CACAGGGTGTTCCCTTGATGTGG + Intergenic
958819027 3:98951723-98951745 CATGGGGTGATCCCTCAGTGTGG + Intergenic
959006483 3:101026163-101026185 CATGGGGTGGTCCTTTAATGTGG + Intergenic
959009646 3:101060741-101060763 CATGGGGTGCTCCCTTGATGTGG + Intergenic
959125821 3:102289857-102289879 CATGGGGTGCTCCATTGATGTGG + Intronic
959361885 3:105403541-105403563 CACAGGGTGCTCCCTTGATGTGG - Intronic
959815336 3:110667387-110667409 CACAGGGTGATCCCTTGATGTGG - Intergenic
960578052 3:119246358-119246380 CATGGGGTGACCCCTTGATGTGG - Intergenic
960756549 3:121019730-121019752 CATGGAGTGATCCCTTAATGTGG - Intronic
961967868 3:130925257-130925279 CATGGGGTTCTCCCTTGATGTGG + Intronic
962244387 3:133779611-133779633 CCTGGGGTTTTCTCTTGATCTGG + Intergenic
962530611 3:136276895-136276917 CATGGGGTATTCCCTTGGTGTGG + Intronic
962983911 3:140517501-140517523 CAAGGGGTACTTCCTTGATGTGG + Intronic
963023494 3:140896541-140896563 CATGGGATGATCCCTTGATGTGG + Intergenic
963171235 3:142252894-142252916 CATGGGGTGGTCTCTTGATGTGG - Intergenic
963373788 3:144437573-144437595 CACAGGGTGTTCCCTTGAAATGG + Intergenic
963522430 3:146372500-146372522 TATAGGGTGCTCCCTTGATGTGG + Intergenic
963832554 3:150023497-150023519 CATGGGGTGCTCCCTTGATGTGG - Intronic
964017574 3:151965542-151965564 CATGGGGTGTTCCCTTGATGTGG - Intergenic
964226544 3:154409185-154409207 CACGGGATGATCCCTTGATGTGG - Intronic
964331650 3:155609351-155609373 CATGGGGCGATTGCTTGATGTGG - Intronic
964393241 3:156218917-156218939 CACAGAGTGCTCCCTTGATGTGG - Intronic
964457589 3:156885466-156885488 CATGGGATGATCCCTTGATGTGG + Intronic
964635905 3:158858608-158858630 CATGGGGTGTTCCCTTGTTGTGG + Intergenic
964867453 3:161276771-161276793 CGTGGAGTGCTCCCTTAATGTGG - Intergenic
964985331 3:162731822-162731844 CACAGGGTGCTCCCTTGATTTGG + Intergenic
965296562 3:166955112-166955134 CGTGGGGTGATCCCTTGATGTGG + Intergenic
965345244 3:167540503-167540525 GGTGGGGTGGTCCCTTGCTGTGG - Intronic
966092829 3:176160373-176160395 CACAGGGTGGTCCCTTGATGTGG - Intergenic
966352687 3:179047313-179047335 CACAGGGTGCTCCCCTGATGTGG - Intronic
966553317 3:181230014-181230036 CACAGGGTGATCCCTTGATGTGG + Intergenic
967203303 3:187094945-187094967 CACACGGTGTTCCCGTGATGTGG - Intergenic
967246489 3:187491981-187492003 CATGGGGTGATCCCTTGATGTGG - Intergenic
967958599 3:194900363-194900385 CACAGGGTGATTCCTTGATGTGG + Intergenic
968896480 4:3406783-3406805 CATGGGGTGGTCCCTTTCCGAGG - Intronic
969545620 4:7825308-7825330 CAGGGGTTGTTCCTTTTATGCGG + Intronic
970283043 4:14479026-14479048 CATGGGGTGGTCCCTTGATGTGG - Intergenic
970856252 4:20651916-20651938 CATGGGGTGATCCCTCGATGTGG - Intergenic
971050316 4:22854977-22854999 TATGGGGTGCTCCCTTGATGTGG + Intergenic
971472169 4:27039461-27039483 CATTGGGTGGTCCCTTGATGTGG + Intergenic
971721894 4:30255740-30255762 CAAGGGGTGCTCCCTTGATATGG + Intergenic
972209924 4:36824224-36824246 CATAAGGTGCTCCTTTGATGTGG - Intergenic
972806554 4:42533980-42534002 CATGGAGTACTCCCTTGATTTGG - Intronic
972899685 4:43668420-43668442 CATGGGGTGATCCCCTGATGTGG + Intergenic
973342971 4:49025537-49025559 CATAGGGTGCTCCCCTGATGTGG + Intronic
974430316 4:61788492-61788514 CACGGGGTGATCCCTTGATGTGG - Intronic
974472182 4:62332247-62332269 CATGGGGTGCTCCCTTGATGTGG - Intergenic
974857486 4:67477511-67477533 CATGGAGTGATCCCTTGATGTGG - Intronic
974951049 4:68583059-68583081 TATGGGGTGTTCCCTTGTTGTGG - Intronic
975203179 4:71615340-71615362 CATGGAGTGCTCCCTTGATGTGG - Intergenic
975365128 4:73520465-73520487 CACAGGCTGCTCCCTTGATGTGG + Intergenic
975534676 4:75436391-75436413 CATGGGGTGCTCCCTTTATGTGG - Intergenic
975614058 4:76229524-76229546 TATAGGGTGATCCCTTGATGTGG + Intronic
975623327 4:76315927-76315949 CACAGGGTGACCCCTTGATGTGG - Intronic
975928619 4:79491354-79491376 TATGGGGTGATCCCTTGATGTGG + Intergenic
975942910 4:79668887-79668909 CATGGGGTACTCCCTTGGTGTGG - Intergenic
975951119 4:79772294-79772316 CATGGGGTGATCCCTTGATGTGG - Intergenic
976501532 4:85796012-85796034 GAAGGGCTGTTCCCTGGATGTGG + Intronic
976562682 4:86520794-86520816 CACATGGTGATCCCTTGATGTGG + Intronic
976791353 4:88881434-88881456 CATGGGGTGTTCCCTTGATGTGG - Intronic
976907923 4:90263186-90263208 CATGGCATGTTCCCTAGAAGTGG + Intronic
976918242 4:90404820-90404842 CACAGAGTGCTCCCTTGATGTGG - Intronic
977510133 4:97952455-97952477 CATGGAGCGTCCCCTTAATGTGG + Intronic
977635622 4:99294272-99294294 TATAGGATGCTCCCTTGATGTGG - Intergenic
977654371 4:99504483-99504505 CAAGAGGTGCTCCCTTGATGTGG + Intergenic
977762856 4:100759843-100759865 CCATGGGTGATCCCTTGATGTGG - Intronic
977828779 4:101565131-101565153 CACAGGGTGCTCCCTTGATTTGG - Intronic
977905791 4:102476230-102476252 CACAGGGTGATCCCTTGATATGG - Intergenic
978027549 4:103896482-103896504 CAGAGGGTGATCCCTTGATGTGG - Intergenic
979030084 4:115632976-115632998 CATGGGGTGCTCCCTTGATGTGG + Intergenic
979357080 4:119716646-119716668 CACGAGGTGATCCTTTGATGTGG - Intergenic
979434716 4:120674341-120674363 CATGGAGTGATCCCTTGATGTGG - Intergenic
979584742 4:122403173-122403195 CATGGGGTGAGCCCTTGATGTGG + Intronic
979664251 4:123293412-123293434 CACAGGGTGCTCCCTTGATATGG + Intronic
979712597 4:123797819-123797841 CATGGGGTGATCCCTTGATATGG + Intergenic
980087685 4:128409020-128409042 CATAGGTTGATCCCTTGATGTGG + Intergenic
980238796 4:130145733-130145755 CAGGCAGTGTTCCCTGGATGAGG - Intergenic
980391997 4:132159064-132159086 CACTGGGTGATCCCTTGATGTGG + Intergenic
980761348 4:137238383-137238405 CATGGGGTGCTCTCTTGATGTGG + Intergenic
980860977 4:138499532-138499554 CATGAGGTGCTCCCTTCATGTGG + Intergenic
981177763 4:141702235-141702257 CATGGGGTGTTCTCTTGATATGG + Intronic
981442440 4:144798771-144798793 TATGGGGTGATCCCTTGAGGTGG + Intergenic
982049971 4:151490466-151490488 CACAGGGTGATCCCTTGATGTGG - Intronic
982187747 4:152819631-152819653 CACGGGGTACTCCCTTAATGTGG - Intronic
982299432 4:153864483-153864505 CACAGGGTGCTCCCTTGATGTGG + Intergenic
982451136 4:155553055-155553077 CACAGGGTGCTCCCTTGATGTGG - Intergenic
982800208 4:159697081-159697103 CATGGGATGACCTCTTGATGTGG + Intergenic
982845392 4:160246393-160246415 CACAGGGTTTTCCCTTGATGTGG + Intergenic
982960244 4:161827137-161827159 CACAGGGTGCTCCCTTGATGTGG + Intronic
982991886 4:162286637-162286659 CATGGGGTGCTCCCTTGATGTGG - Intergenic
983155909 4:164348439-164348461 CATGGTTTGTTCCCTTGACCTGG + Intronic
983546933 4:168975087-168975109 CATGGGGTGATCCCTTGATGTGG + Intronic
983661513 4:170134554-170134576 CACAGGGTGTTCCCTTGATGTGG + Intergenic
983729770 4:170978864-170978886 CATGGGGTACTCCCTTGATGTGG + Intergenic
983776221 4:171610304-171610326 CACAGGGTGTTCCCTGAATGTGG - Intergenic
983807857 4:172017693-172017715 CACGGGGTGATCCCTTCATATGG + Intronic
983845497 4:172513601-172513623 CACAGGGTACTCCCTTGATGTGG + Intronic
983894455 4:173067612-173067634 CATGGGGTGATCCCTTAATGTGG + Intergenic
983962987 4:173777511-173777533 CACAGGGTGCTCCCTTGATGTGG + Intergenic
984190526 4:176600677-176600699 CACAGGGTGCTCCCTTGATATGG + Intergenic
984234370 4:177137845-177137867 CATGGGGTGCTCCCTGGGTGTGG - Intergenic
985108219 4:186520265-186520287 CATGGGGGACTCCCTTGATGTGG + Intronic
985394753 4:189530615-189530637 TATGGGATGTTCGCTTGATGCGG + Intergenic
985561817 5:591760-591782 CACAGGGTGTTCCCTTGAGGTGG + Intergenic
986242193 5:5971066-5971088 CCAGGGGTCTTCCCATGATGGGG + Intergenic
986259101 5:6126770-6126792 CATGGGGTGCTCCCTTGATGTGG - Intergenic
986617780 5:9638105-9638127 CATGGGGTGATCCCTCAATGTGG + Intronic
986634076 5:9802384-9802406 CACGGGGTGCTCCTTTGATGAGG - Intergenic
987436813 5:17905408-17905430 CACGAGGTGTTCCCTTGATGTGG + Intergenic
987563656 5:19556081-19556103 CACAGGATGTTTCCTTGATGTGG - Intronic
987640207 5:20602333-20602355 CCAGGGATGCTCCCTTGATGTGG - Intergenic
987704304 5:21443839-21443861 CACGGGGTGTTCCCTCAATGAGG + Intergenic
987916933 5:24227224-24227246 CACAAAGTGTTCCCTTGATGTGG + Intergenic
988002303 5:25363692-25363714 CATGGTGTTCTCCCTTGATGTGG - Intergenic
988260735 5:28883230-28883252 CATGAGGTGTTCCCTTAATGTGG - Intergenic
988278348 5:29113005-29113027 CACAGGGTGATCCCTTGATATGG + Intergenic
988716364 5:33832659-33832681 GGTGGTGTTTTCCCTTGATGCGG + Intronic
988725090 5:33919119-33919141 CATGGGGTGCTCCCTTGATGTGG + Intergenic
988929633 5:36024364-36024386 CACAGGGTGCTCCCTTGATATGG - Intergenic
989355383 5:40538804-40538826 CATGGGTTGCTCCCTAGATGTGG + Intergenic
989365782 5:40653513-40653535 CACGGGGTGTTCTGTTAATGTGG - Intergenic
989431458 5:41360540-41360562 CACGGAGTGCTCCCTTGATGTGG + Intronic
989562697 5:42870365-42870387 CACAGGGTGCTCCCTTGATGTGG + Intronic
989727539 5:44604354-44604376 CACAGGGTGCTCCCTTGATGTGG - Intergenic
990005478 5:50939632-50939654 ATTGGGTTGATCCCTTGATGTGG - Intergenic
990918495 5:60936959-60936981 CACGAGGTGCTCCCTTGATTTGG + Intronic
991137010 5:63193835-63193857 CACAAGGTGTTCCCTTGATATGG - Intergenic
991157591 5:63457968-63457990 CATGGGTTGTTTCCTTTATTAGG - Intergenic
991414708 5:66380088-66380110 CATGGGGTGATCCCTTGATGTGG - Intergenic
991543264 5:67752642-67752664 CACGGGGTGATCTCTTGATGTGG - Intergenic
992239534 5:74752865-74752887 CACGGGGTGCTCCCTTGATGTGG - Intronic
992599762 5:78387640-78387662 CACGGGGTGCTCCCTTGATGTGG + Intronic
992898732 5:81270922-81270944 CACAGGGTGCTCCCTTGATGTGG - Intergenic
993365957 5:87034710-87034732 CATGAGGTGATTCTTTGATGTGG + Intergenic
993920422 5:93794600-93794622 CACAGGGTGCTCCCTTGATGTGG + Intronic
994034106 5:95178633-95178655 CATGGGGTGCTCCTTTGATGTGG - Intronic
994347306 5:98701466-98701488 CCATGGGTGTTCCTTTGATGTGG - Intergenic
994496361 5:100517963-100517985 CATTGGGTGCTCCCTTAATGTGG - Intergenic
994550675 5:101231289-101231311 TACAGGGTGTTCCCTTGATGTGG + Intergenic
994636202 5:102346757-102346779 CATGGTGTGATCCCTTGATGTGG + Intergenic
994646072 5:102470645-102470667 CATGGGGTGTTCCCTTGATGTGG + Intronic
994778074 5:104060996-104061018 CACAGGGTGATCCCTTGATGTGG + Intergenic
995115397 5:108472725-108472747 CATGGAGTGCTCCCTTGGTGTGG - Intergenic
995597780 5:113765985-113766007 CATGTGCTGTACCCATGATGTGG - Intergenic
995699025 5:114912837-114912859 CATGGGGTGCTGCCTTGATGTGG - Intergenic
996495221 5:124148100-124148122 CACGGAGTGCTCCCTTGATGTGG + Intergenic
996608918 5:125356954-125356976 CAAGTGGTGATCCCTTAATGTGG + Intergenic
996616038 5:125441887-125441909 CATGGGGTGCTCCCTTAATGTGG - Intergenic
996631944 5:125643234-125643256 CATAGGGTGATCCCTTGATGTGG - Intergenic
996875283 5:128234623-128234645 CACGGGGTGCTCCATTGAAGTGG + Intergenic
997005008 5:129806293-129806315 CATAGGGTGCTCCCTTGATGTGG + Intergenic
997206160 5:132051458-132051480 CCATGGGTTTTCCCTTGATGGGG - Intergenic
997231007 5:132243189-132243211 CATGGGGTGTTCCCTTGATGTGG + Intronic
997798251 5:136833576-136833598 CATGGGATGCTCCTTTAATGTGG + Intergenic
998741734 5:145210620-145210642 CATGGGGTGGTTCCTTGATGTGG - Intergenic
999086188 5:148892359-148892381 CACGGTGTGTTCCCTTGATGTGG - Intergenic
999108726 5:149096107-149096129 TAGGGGGTGATGCCTTGATGTGG - Intergenic
999930830 5:156431627-156431649 CACGGGGTAATCCCTTGATGTGG + Intronic
1000200571 5:159006176-159006198 CATGCAGTTTTCTCTTGATGGGG - Intronic
1000237637 5:159377174-159377196 CATAGGGTGATCCATTGATGTGG - Intergenic
1001234888 5:170021300-170021322 CATGGCGTGTGCCCTTTACGTGG - Intronic
1001693682 5:173653574-173653596 CATGGGGTGCTCCCTTGATTTGG + Intergenic
1002849291 6:979017-979039 CATGGGGTGATCCCTTGATGTGG + Intergenic
1002900149 6:1404355-1404377 CATGGGGTGTCCCCTTGCAATGG + Intergenic
1003406148 6:5828641-5828663 GATGGGGAGTCCCCTTAATGGGG + Intergenic
1003582039 6:7348381-7348403 CATGGGGTGTTCCCTTGATGGGG - Intronic
1004096642 6:12561181-12561203 CATGGGGCGATCCCTTGATGTGG - Intergenic
1004554812 6:16685363-16685385 CATTGGGTTTTCCCTTTCTGGGG + Intronic
1004600390 6:17144608-17144630 CATAGGGTGCTCCCTTGATGTGG + Intergenic
1005259379 6:24042039-24042061 CACAGGGTGATCCCTTGATGTGG + Intergenic
1005391951 6:25343088-25343110 CATTGGGTGTTTCCTCAATGTGG + Intronic
1005656127 6:27939420-27939442 CATGAGGTGTTTGCTTTATGTGG + Intergenic
1006609600 6:35286257-35286279 CATGGAGGGGTCCCTTGGTGGGG - Intronic
1007349623 6:41259547-41259569 CAAAGGGTGATCCCTTGGTGTGG - Intergenic
1007438698 6:41838578-41838600 CACAGAGTGATCCCTTGATGTGG - Intronic
1008042197 6:46814730-46814752 CACAGGGTGCTCCCTTGATGTGG + Intronic
1008185802 6:48388951-48388973 CATGGGATGTTCCCTTGATGCGG + Intergenic
1008231299 6:48987275-48987297 CATGGAGTGCTCCCTCGATATGG - Intergenic
1008402245 6:51077728-51077750 CACAGTGTGCTCCCTTGATGTGG + Intergenic
1008882510 6:56395131-56395153 CATGGGGTGTTCCCTTAATGTGG - Intergenic
1009360196 6:62802360-62802382 CATGGGATGATCCCTTGATGTGG + Intergenic
1009392053 6:63156092-63156114 CATGGGGTGCTTTCTTGAAGTGG - Intergenic
1009589217 6:65643880-65643902 CACCGCGTGCTCCCTTGATGTGG - Intronic
1009779725 6:68255150-68255172 CATGGGCTGATTCCTTGATGTGG + Intergenic
1010015538 6:71101662-71101684 TCATGGGTGTTCCCTTGATGTGG + Intergenic
1010518376 6:76802721-76802743 CATGGGGTGCTCCCTTGATGTGG + Intergenic
1010817473 6:80375834-80375856 CATGGGGAGCTTGCTTGATGTGG + Intergenic
1010862954 6:80936952-80936974 CATGGGGTGCTCCCTTGATGTGG + Intergenic
1010976009 6:82314012-82314034 CATGGGGTGATCCCTTGATATGG - Intergenic
1011156552 6:84340326-84340348 CATGGGGTGCTCCCTGGTTGTGG + Intergenic
1011225282 6:85097837-85097859 CATGGTATACTCCCTTGATGTGG - Intergenic
1011832311 6:91388169-91388191 CATGGGATGCTCCCTTGATATGG - Intergenic
1011923870 6:92617761-92617783 CACCGGTTGTTCCCTTGATGTGG + Intergenic
1012079457 6:94736873-94736895 CATAGGGTGTTCCCTTCATGTGG - Intergenic
1012191742 6:96288010-96288032 CATGGCATGTTCTCTTGATATGG - Intergenic
1012203447 6:96434720-96434742 CACAGGATGATCCCTTGATGTGG + Intergenic
1012299143 6:97563192-97563214 CATGGGGTGCTCCCTTGATATGG + Intergenic
1012696577 6:102391620-102391642 CGTAGGCTGTTCCCTTGATGTGG - Intergenic
1013495074 6:110689911-110689933 CACGGGATGTTCCTTTGATATGG - Intronic
1013985451 6:116187047-116187069 CACAGGGTGCTCCCTTGTTGTGG + Intronic
1014235082 6:118944994-118945016 CATGCAGTGATCCCTTGATGTGG - Intergenic
1014278502 6:119415943-119415965 CACGGGGTGATCCCTTGATGTGG + Intergenic
1014313104 6:119830213-119830235 CATGGGGTATTCCCTTGATGTGG + Intergenic
1014420991 6:121245414-121245436 CACAGGGTGTTCCCTTGATGTGG - Intronic
1014481950 6:121950451-121950473 TCAAGGGTGTTCCCTTGATGTGG + Intergenic
1014532014 6:122569787-122569809 CACGGGGTGTTCCCTTGATGTGG - Intronic
1014566646 6:122956891-122956913 CACGGGGTGTTCCCTTAATATGG - Intergenic
1014658175 6:124132916-124132938 CATGGTGTGATACCTTGATGTGG - Intronic
1014792679 6:125692814-125692836 CATGGGGTAATCCCTTGATATGG + Intergenic
1014831775 6:126111151-126111173 CATGGGGTGGAATCTTGATGAGG + Intergenic
1014878122 6:126686001-126686023 CATGGGTTGATCCCTTGATGTGG - Intergenic
1015347913 6:132180853-132180875 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1016216229 6:141607445-141607467 CTTGGGGTGCTCCCTTGATATGG + Intergenic
1016425537 6:143932842-143932864 CACAGGGTGAACCCTTGATGTGG + Intronic
1016498283 6:144689476-144689498 CACGGGTTGCTCCCTTGATGTGG + Intronic
1018168659 6:161126480-161126502 CACGGGGTGCTCCCTTGATGTGG + Intergenic
1018681772 6:166270959-166270981 CATGGGATGTCCCCCTTATGTGG + Intergenic
1018704194 6:166450694-166450716 CCTGGGGTGGTCCCTTGTGGTGG - Intronic
1018755372 6:166843727-166843749 CATGGGGTACTCCCTTGATGTGG - Intronic
1019123372 6:169823409-169823431 CACGAGGTGCTCCCTTGATGTGG + Intergenic
1019123822 6:169825844-169825866 CATGGGGTGCTCCCTTGACATGG + Intergenic
1020332265 7:7031987-7032009 CATGAAGTGGTCCCTTGGTGTGG + Intergenic
1021340153 7:19455262-19455284 CATGGGGTGCTCTCTTTATGTGG + Intergenic
1023144466 7:37135684-37135706 TACAGGGTGCTCCCTTGATGTGG - Intronic
1023537650 7:41230929-41230951 CCTGGGGTGCTCCCTTGGTGTGG + Intergenic
1023871033 7:44263187-44263209 CGAAGGGTGTTCCCTTGGTGGGG - Intronic
1024367213 7:48535191-48535213 CACAGGGTGCTCCCTTCATGTGG + Intronic
1024665520 7:51543548-51543570 CACAGTGTGCTCCCTTGATGTGG + Intergenic
1024876128 7:54026045-54026067 CATGGGGTGCTCCCTTGATGTGG + Intergenic
1024893305 7:54227228-54227250 CCAGGCATGTTCCCTTGATGTGG - Intergenic
1024900613 7:54315159-54315181 CCAGGCATGTTCCCTTGATGTGG + Intergenic
1026326622 7:69316028-69316050 CTTCAGATGTTCCCTTGATGTGG - Intergenic
1027563483 7:79761947-79761969 CATGGGGTGCTCACTTGGTGTGG + Intergenic
1027691614 7:81354049-81354071 CACAGGGTGCTCCCTTGATATGG + Intergenic
1027733217 7:81902430-81902452 CACAAGGTGATCCCTTGATGTGG + Intergenic
1028017693 7:85736031-85736053 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1028250848 7:88538981-88539003 CACAGGGTGCTCCTTTGATGTGG + Intergenic
1028501924 7:91528206-91528228 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1028529560 7:91824121-91824143 CATAGGGTATTACCTGGATGTGG + Intronic
1028792827 7:94873149-94873171 CACGGGGTGCTCTCTTGATGTGG + Intergenic
1028819518 7:95190206-95190228 CCATGGGTGATCCCTTGATGTGG + Intronic
1030255493 7:107505761-107505783 CCATGGGTGGTCCCTTGATGTGG + Intronic
1030310361 7:108062941-108062963 CATGGAGTGTCCCCCTGGTGGGG - Exonic
1030455886 7:109773112-109773134 CACAGGGTGTGCCCTTGATTTGG - Intergenic
1030478822 7:110075906-110075928 TATAGGGTCTTGCCTTGATGTGG + Intergenic
1030972416 7:116076231-116076253 TATGGTGTGCTCCCTTGATGTGG - Intronic
1031090338 7:117347390-117347412 TACAGGGTGTTCCCTTGATGTGG + Intergenic
1031220341 7:118957603-118957625 CACGGGATGGTCCCTTAATGTGG + Intergenic
1031576748 7:123423301-123423323 CATAGGGTGCTCTGTTGATGTGG - Intergenic
1031799297 7:126222944-126222966 CATGGGGTGATCCCTTGACGTGG + Intergenic
1032931613 7:136678573-136678595 CACGGGGTGATCCCTTTATATGG - Intergenic
1032935790 7:136729759-136729781 TTCGGGGTGCTCCCTTGATGTGG - Intergenic
1033026923 7:137782937-137782959 CACGGGGTGCTCCCTTGATGTGG - Intronic
1033492224 7:141854796-141854818 CATGGGGTTTTCCCTTGATATGG + Intergenic
1033630824 7:143155836-143155858 CATGGGGTGTTCCTATGACCAGG - Intergenic
1034019598 7:147627125-147627147 CACAGGGTGATCCCTTGATGTGG - Intronic
1034058813 7:148067282-148067304 CATGGGGTGATGCCTTGATGTGG + Intronic
1034247779 7:149662119-149662141 CATGGGGTGATCCCTTGATGTGG + Intergenic
1035591394 8:817647-817669 CACGGGGTGCTACCTTGATGTGG + Intergenic
1036272683 8:7321771-7321793 CCCAGGGTGCTCCCTTGATGTGG - Intergenic
1036348665 8:7988573-7988595 CCCAGGGTGCTCCCTTGATGTGG + Intergenic
1036843932 8:12149045-12149067 CCCAGGGTGCTCCCTTGATGTGG + Intergenic
1036865303 8:12391366-12391388 CCCAGGGTGCTCCCTTGATGTGG + Intergenic
1038054411 8:23844781-23844803 CATGGGATGTGCGTTTGATGTGG + Exonic
1038908843 8:31938365-31938387 CATGAGGTGCCCCCTTGATGTGG - Intronic
1039198512 8:35060173-35060195 GATGAGGTGTTCCCTTGATGTGG + Intergenic
1039763846 8:40607712-40607734 CACAGAGTGCTCCCTTGATGTGG + Intronic
1039811230 8:41049961-41049983 CAAGGGGTGCTCCCTTGATATGG - Intergenic
1040362771 8:46683483-46683505 CATGGGGTGGTACCTTAATATGG + Intergenic
1040529266 8:48253279-48253301 CAAAGGGTACTCCCTTGATGTGG + Intergenic
1040820252 8:51547650-51547672 CATGGGGTGATCCCTTGATGTGG - Intronic
1040867908 8:52069662-52069684 CATGGGGTGATCCCTTGATGTGG + Intergenic
1041897232 8:62938708-62938730 CATGGGGTGCTGCCTTGATGTGG - Intronic
1042160664 8:65890908-65890930 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1042728929 8:71910009-71910031 CACGGGCTGATCCCTTGATGTGG + Intronic
1042768341 8:72352172-72352194 CACAGGGTGCTCCCTTGATTTGG + Intergenic
1042896935 8:73680428-73680450 CACGGGATGATCCCTTGATGTGG - Intronic
1042995619 8:74694316-74694338 CATGGGTTGCTCCCTTCATGTGG - Intronic
1043104302 8:76089212-76089234 CTTGGGGTGATCCCTTGATGTGG + Intergenic
1043537714 8:81225180-81225202 CATGGGGTGATCCTTTGATGTGG + Intergenic
1043616467 8:82130924-82130946 CACAGGGTGATCCTTTGATGTGG - Intergenic
1043679010 8:82997595-82997617 CATGGAGTGCTCCCTTAATGTGG - Intergenic
1043876338 8:85491139-85491161 CATGGGGTGCTTCCTTGATGTGG + Intergenic
1043986231 8:86695829-86695851 CATGGAGTAATCCCTTGATTTGG + Intronic
1043987904 8:86715503-86715525 CATGGGGTGCTCCCATGATGTGG - Intronic
1044880201 8:96715754-96715776 CATGGGGTGCTCCCTTGATGTGG + Intronic
1045671133 8:104554081-104554103 CATGGGTTGCTCCCTTGATGTGG - Intronic
1045952221 8:107865209-107865231 CACAGGGTGATCCCTTGAGGTGG + Intergenic
1046238871 8:111464237-111464259 CACAGGGTGTTCCCTTGATGTGG - Intergenic
1046284742 8:112080018-112080040 CACAGGGTGTTCCCTTGATGTGG + Intergenic
1046448785 8:114359674-114359696 CATCAGGTGATCTCTTGATGTGG - Intergenic
1047022167 8:120786254-120786276 CACAGGGTGCTCCCTTAATGTGG - Intronic
1047312849 8:123706907-123706929 CATGGGCTGTTCCCCTCATCTGG + Intronic
1047384256 8:124394974-124394996 CTTGAGGTGTTCCGTTGATGTGG + Intergenic
1047607294 8:126488123-126488145 CATGGGATGCTCCCTTGATATGG + Intergenic
1047634293 8:126743775-126743797 CGTTGGGTGTTCCCTTGATGTGG + Intergenic
1047798090 8:128278267-128278289 AAAGGGATGCTCCCTTGATGTGG - Intergenic
1047842482 8:128767713-128767735 CATGGGATGATCCCTTGATGTGG - Intergenic
1047890347 8:129302393-129302415 CATGGAGTGCTCCCTTGATATGG + Intergenic
1047901789 8:129431243-129431265 CATAGGCTGCTCCCTTGATGTGG + Intergenic
1050133817 9:2441032-2441054 CACAGGGTGATCCCTTGATGTGG + Intergenic
1050903551 9:10975314-10975336 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1051601263 9:18877412-18877434 CACAGGGTGCTCCCTTGATGTGG + Intronic
1051881265 9:21841736-21841758 CATGGGGTGATCCCTTGATGTGG - Intronic
1051929547 9:22367925-22367947 CATGGGATGCTCCCTTGATGTGG - Intergenic
1052091997 9:24339946-24339968 GCTGGGGTGTTTCCTTGATGTGG + Intergenic
1052307285 9:27024473-27024495 CATGAGGTGATCCCTTGATGTGG - Intronic
1052624825 9:30961913-30961935 CATGGGGTGTTTCCTTGATGTGG + Intergenic
1053231634 9:36415503-36415525 CATGGGGTGATCCCCTGACATGG + Intronic
1053247734 9:36548727-36548749 CATGGGGTGTTCCCTTGATGTGG - Intergenic
1054844720 9:69782033-69782055 CATGGGGTGGTCCCTTGATATGG + Intergenic
1055137999 9:72844840-72844862 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1055846620 9:80572546-80572568 CACATGGTGTTCCCTTGATGTGG - Intergenic
1055912133 9:81364734-81364756 CATAGGGTGTTTTCTTGATGTGG - Intergenic
1056309543 9:85324969-85324991 CATGGGGTGATCCCTTGATGTGG - Intergenic
1056696301 9:88856860-88856882 CACAGGGTGCTCCCTTGATATGG - Intergenic
1056948155 9:91018271-91018293 CACAGGGTGCTCCTTTGATGTGG - Intergenic
1057340539 9:94197674-94197696 CATGGGGTGTTCCCTTGATGTGG + Intergenic
1058272193 9:102986329-102986351 CCGTGGGAGTTCCCTTGATGTGG - Intergenic
1058784468 9:108373927-108373949 CACGGGGTGATCCCTTGATGTGG + Intergenic
1059673864 9:116517462-116517484 CATGGGGTGCTCCCTTAATGTGG - Intronic
1059827635 9:118049784-118049806 TACAGGGTGCTCCCTTGATGTGG + Intergenic
1059833983 9:118129361-118129383 CACAGGGTATTCCCTTGATATGG - Intergenic
1060314371 9:122495869-122495891 TACCGGGTGCTCCCTTGATGTGG + Intergenic
1062713696 9:137990910-137990932 TTGGGGGTGCTCCCTTGATGTGG - Intronic
1186308471 X:8290459-8290481 CATGGGGTGCTCCCTTGAAGTGG - Intergenic
1186963151 X:14758680-14758702 CACAGGGTGCTCCCTTGATATGG - Intergenic
1187109199 X:16278811-16278833 ACAGGGGTGTTCCCTTGATGTGG + Intergenic
1187449310 X:19382721-19382743 CATCGGATGTTCCCTTCTTGGGG - Intronic
1187588942 X:20694023-20694045 CATGGGGTGTTCCCTTGATGTGG - Intergenic
1187790149 X:22941787-22941809 CACGGGGTGGTCCCTTGATGTGG - Intergenic
1188389265 X:29600205-29600227 CGCAGGGTGCTCCCTTGATGTGG + Intronic
1188708997 X:33371193-33371215 CACAGCGTGATCCCTTGATGTGG + Intergenic
1188790581 X:34404231-34404253 AGTGGGGTGTTCCCTTGATGTGG + Intergenic
1188870512 X:35365366-35365388 CGTGGAGTATTCCCTTGCTGTGG - Intergenic
1188956165 X:36436899-36436921 CACGGGGTGTTCCCTTGAGATGG - Intergenic
1189265628 X:39714151-39714173 CATGGGCTGTTCTCTTCATCTGG - Intergenic
1189567297 X:42255612-42255634 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1189639226 X:43050224-43050246 AACAGGGTGATCCCTTGATGTGG + Intergenic
1189663285 X:43326640-43326662 CAAGGGGTGATTCCTTAATGTGG + Intergenic
1190774539 X:53542191-53542213 TATGGGGTTTTCTCTTGTTGTGG - Intronic
1191008562 X:55737641-55737663 CACAGGGTGCTCCCTTGATGTGG + Intronic
1191026612 X:55920227-55920249 CACGGGGTGCTCCCTTGATGTGG - Intergenic
1191138697 X:57093337-57093359 CTTGGGTTGCTCCCTTGATGTGG - Intergenic
1191147027 X:57177915-57177937 CATGGGGTGCTTTCTTAATGTGG + Intergenic
1191223176 X:58013683-58013705 AATGGGGTGCTACCTTGACGTGG + Intergenic
1191616779 X:63177628-63177650 CATGGGGTGTTCCCTTGATGTGG - Intergenic
1191619518 X:63201295-63201317 CATGGGGTGTTCCCTTGATGTGG + Intergenic
1191679172 X:63824634-63824656 CACAGGGTGATTCCTTGATGTGG + Intergenic
1191784434 X:64902887-64902909 TATCAGGTGATCCCTTGATGTGG + Intergenic
1191787611 X:64934151-64934173 CACAGGGTGTTACCTTGTTGTGG + Intronic
1191805053 X:65127183-65127205 CACAGGGTGCTCCCTTGGTGTGG + Intergenic
1191813695 X:65219130-65219152 CATGGCATGCTCCCTTGATATGG - Intergenic
1191888843 X:65920054-65920076 CATAGGGTGATCCCTTGATGTGG + Intergenic
1191917313 X:66216527-66216549 CACAGGGTGCTCCCTGGATGTGG - Intronic
1191970873 X:66815077-66815099 CACAGGGTGCTCCCATGATGTGG + Intergenic
1192009048 X:67248366-67248388 CACAGGGTGATCCTTTGATGTGG - Intergenic
1192297275 X:69864417-69864439 TACGAGGTGCTCCCTTGATGTGG - Intronic
1192673921 X:73175183-73175205 CATGAGGCAATCCCTTGATGTGG + Intergenic
1192713749 X:73617964-73617986 CATGGGGTGCTTCATTGCTGTGG + Intronic
1192852923 X:74977053-74977075 CAAAAGGTGCTCCCTTGATGTGG + Intergenic
1192853465 X:74981747-74981769 CACAGGGTGATCCCTTAATGTGG - Intergenic
1192876093 X:75230909-75230931 CATAGGGTGATTCATTGATGTGG - Intergenic
1192895547 X:75439849-75439871 CACTGGGTGATCCCTTGATGTGG + Intronic
1192900132 X:75487488-75487510 CATGGGGTGATCCCTTGATGTGG - Intronic
1192944938 X:75956643-75956665 CAGAGGGTGTTCCCTTGATGTGG + Intergenic
1192981709 X:76351119-76351141 TTATGGGTGTTCCCTTGATGTGG - Intergenic
1192991756 X:76467051-76467073 CATGGACTGTTTACTTGATGTGG + Intergenic
1193025288 X:76840136-76840158 CATGGGTTGTTACCCTCATGTGG - Intergenic
1193197025 X:78644073-78644095 CACAGGGTGCTCCCTTGATGTGG - Intergenic
1193255467 X:79343156-79343178 CACAGGGTGATCCCTTGATGTGG - Intergenic
1193300932 X:79887466-79887488 CACATGGTTTTCCCTTGATGTGG - Intergenic
1193382737 X:80834591-80834613 CATGAGGTGATCCCTCTATGTGG - Intergenic
1193386979 X:80883940-80883962 CATGGGGTGTTCCCTTGATGTGG - Intergenic
1193436405 X:81479172-81479194 CATGGGGTGCTTCCTTGTTGTGG - Intergenic
1193447531 X:81622155-81622177 CACGGAGTGCTCCTTTGATGTGG + Intergenic
1193549324 X:82871356-82871378 CACAGGGTGTTCCCTTAATGTGG + Intergenic
1193556605 X:82961281-82961303 CACGAGGTAATCCCTTGATGTGG - Intergenic
1193580021 X:83252572-83252594 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1193736714 X:85165729-85165751 CATGGGGTGATCCCTTGATATGG + Intergenic
1193771631 X:85594068-85594090 ACAGGGGTGTTCCCTTGTTGTGG - Intergenic
1193775862 X:85641416-85641438 CATGGGATACTCCCTTGATGTGG + Intergenic
1193937205 X:87637290-87637312 ATGGGGGTGATCCCTTGATGTGG - Intronic
1194053310 X:89100110-89100132 CATGGGGTAATCCCTTGATATGG + Intergenic
1194095245 X:89631761-89631783 CATGGGGTGCTCCCCGGATGTGG + Intergenic
1194181531 X:90716288-90716310 CATGGGGTGATTCTTTGATGTGG - Intergenic
1194191889 X:90847918-90847940 CACAGGGTGATCCCTTGATGTGG + Intergenic
1194214338 X:91110297-91110319 CATGGGGTGATCCCTTGATGTGG + Intergenic
1194231656 X:91331938-91331960 CATGAGATACTCCCTTGATGTGG - Intergenic
1194262786 X:91717342-91717364 CATGGGGTGATTCCTTGATGTGG - Intergenic
1194353849 X:92856207-92856229 CATGGGGTGATGCCTTGATGTGG - Intergenic
1194381188 X:93193111-93193133 CACGGAGTGTTCCCTTAGTGTGG - Intergenic
1194384532 X:93236759-93236781 CATGAGGTGTTCCCTTGATGTGG - Intergenic
1194445613 X:93983573-93983595 CACGGAGTGCTTCCTTGATGTGG - Intergenic
1194468279 X:94258639-94258661 CACAGGGTGATCCCTTGTTGTGG - Intergenic
1194516052 X:94855190-94855212 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1194614838 X:96087668-96087690 CACAGAGTGTTCCCTTTATGTGG - Intergenic
1194815899 X:98440596-98440618 CACAGGGTGATCCCTTGATGTGG - Intergenic
1194868216 X:99096044-99096066 CACTGAGTGATCCCTTGATGTGG + Intergenic
1194967441 X:100304378-100304400 CATGGGGTGCTCCCTTGATGTGG - Intronic
1195154119 X:102105242-102105264 CACGGGGTGCTCCCTTGATGTGG - Intergenic
1195237186 X:102911813-102911835 CATGGGGTGCTCCCTTGATGTGG - Intergenic
1196477963 X:116111498-116111520 CATGGGGTCCTCTTTTGATGTGG + Intergenic
1196599402 X:117584712-117584734 CACAGGGTGTTCTCTTGATGGGG + Intergenic
1196949086 X:120857839-120857861 CACAGGATGCTCCCTTGATGTGG - Intergenic
1196977820 X:121179692-121179714 TATGGGGTGATCCCTTGATGTGG + Intergenic
1197049939 X:122045959-122045981 CACGGGGTGTTCTTTTGATGTGG + Intergenic
1197371235 X:125628319-125628341 CATGGGGTGATCCCTTGATGTGG - Intergenic
1197493826 X:127153209-127153231 CATGGGGTGTTCCCTTGATATGG + Intergenic
1197556671 X:127964163-127964185 CACAGGGTAATCCCTTGATGTGG + Intergenic
1197603832 X:128561276-128561298 CACGTGGTGATCCCTTGATGTGG - Intergenic
1198604454 X:138321933-138321955 CACAGTATGTTCCCTTGATGTGG + Intergenic
1198664830 X:139008658-139008680 CATGGGGTGGTCCCTTGATATGG - Intronic
1198836858 X:140815132-140815154 CATGGGGCATTCCCCTAATGTGG + Intergenic
1199077147 X:143536820-143536842 CATGGGCCGTTCCCTTGATGTGG - Intergenic
1199121672 X:144061416-144061438 CATGGGGTGCTCCCCTGATATGG - Intergenic
1199170256 X:144726815-144726837 TATGGAGTATTCCCTTGATGTGG - Intergenic
1199282923 X:146022770-146022792 CATGGGGTGATCCCTTGATGGGG - Intergenic
1199332710 X:146581317-146581339 TATGTGGTGTTCCCTTGCTGTGG + Intergenic
1199586951 X:149424370-149424392 CATGGGGTGATCCCTTGATGTGG - Intergenic
1200447879 Y:3287939-3287961 CATGGGGTGCTCCCTGGATGTGG + Intergenic
1200528155 Y:4298203-4298225 CATGGGGTGATTCTTTGATGTGG - Intergenic
1200538527 Y:4430353-4430375 CACAGGGTGATCCCTTGATGTGG + Intergenic
1200644155 Y:5760807-5760829 AATTGGGTGCTCCCTTAATGTGG + Intergenic
1200662209 Y:5973279-5973301 CATGGGGTGATGCCTTGATGTGG - Intergenic
1201391571 Y:13502931-13502953 CATGGGGTGTTCCCTTGATGTGG - Intergenic
1202038132 Y:20655960-20655982 CACTGGGTGTTCCCTTGATATGG - Intergenic