ID: 1191616780

View in Genome Browser
Species Human (GRCh38)
Location X:63177644-63177666
Sequence CCAGATTCTTTTGTCTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191616780_1191616789 14 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616789 X:63177681-63177703 GTGGCAGGTCCTTCCACTGGTGG No data
1191616780_1191616790 15 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616790 X:63177682-63177704 TGGCAGGTCCTTCCACTGGTGGG No data
1191616780_1191616785 -5 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616780_1191616786 -1 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616786 X:63177666-63177688 GAGAGCAGGCCTTGAGTGGCAGG No data
1191616780_1191616788 11 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616788 X:63177678-63177700 TGAGTGGCAGGTCCTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191616780 Original CRISPR CCAGATTCTTTTGTCTCATG GGG (reversed) Intergenic
No off target data available for this crispr