ID: 1191616783

View in Genome Browser
Species Human (GRCh38)
Location X:63177646-63177668
Sequence CTCCAGATTCTTTTGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191616783_1191616786 -3 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616786 X:63177666-63177688 GAGAGCAGGCCTTGAGTGGCAGG No data
1191616783_1191616788 9 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616788 X:63177678-63177700 TGAGTGGCAGGTCCTTCCACTGG No data
1191616783_1191616785 -7 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616783_1191616789 12 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616789 X:63177681-63177703 GTGGCAGGTCCTTCCACTGGTGG No data
1191616783_1191616790 13 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616790 X:63177682-63177704 TGGCAGGTCCTTCCACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191616783 Original CRISPR CTCCAGATTCTTTTGTCTCA TGG (reversed) Intergenic
No off target data available for this crispr