ID: 1191616785

View in Genome Browser
Species Human (GRCh38)
Location X:63177662-63177684
Sequence TCTGGAGAGCAGGCCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191616783_1191616785 -7 Left 1191616783 X:63177646-63177668 CCATGAGACAAAAGAATCTGGAG No data
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616779_1191616785 11 Left 1191616779 X:63177628-63177650 CCACATCAAGGGAACACCCCATG 0: 15
1: 78
2: 144
3: 215
4: 320
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616780_1191616785 -5 Left 1191616780 X:63177644-63177666 CCCCATGAGACAAAAGAATCTGG No data
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data
1191616782_1191616785 -6 Left 1191616782 X:63177645-63177667 CCCATGAGACAAAAGAATCTGGA No data
Right 1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191616785 Original CRISPR TCTGGAGAGCAGGCCTTGAG TGG Intergenic
No off target data available for this crispr