ID: 1191619054

View in Genome Browser
Species Human (GRCh38)
Location X:63196502-63196524
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 13, 1: 20, 2: 18, 3: 48, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191619054 Original CRISPR TGGGACTCCTTGGGAAAAAC AGG (reversed) Intergenic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG + Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923982742 1:239343662-239343684 TGGGACTCTTTTGGAACAAATGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1074037923 10:109759600-109759622 TGGGACTCATTGGGTATCACTGG - Intergenic
1075635053 10:124024960-124024982 TGGGCATCTTTGGTAAAAACTGG - Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081981301 11:47268991-47269013 TGGGGCCCTGTGGGAAAAACAGG - Intronic
1082834527 11:57641854-57641876 TAGGCCTCCTTGAGAAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1084958251 11:72702912-72702934 TGGAATTCCTTCGGAACAACCGG - Exonic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG + Intergenic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1100111600 12:91250468-91250490 TGGGACTCTTTGAGAACATCTGG + Intergenic
1100959296 12:99944820-99944842 AGGGATTGCTAGGGAAAAACTGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102636045 12:114324997-114325019 TGGTTCTCCTAAGGAAAAACTGG + Intergenic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG + Intergenic
1122131560 14:99606816-99606838 TGGGAATGCTTGGGCAGAACAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1123190553 14:106565386-106565408 TGGGTCTCTTTGTCAAAAACCGG - Intergenic
1123907928 15:24938713-24938735 GGGGACTCCAAGGGAAACACAGG + Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1128148317 15:65344983-65345005 TGGGACTGCTTTTGAAAACCTGG - Intronic
1131053392 15:89362313-89362335 TGCGACTCCCAGGGAAAAGCTGG + Intergenic
1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG + Intronic
1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG + Intergenic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1134307474 16:13046124-13046146 TGCCTCTCCTTGGGAAAAGCAGG + Intronic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1140908237 16:79428434-79428456 TGGGACTCCAAGGGAGCAACAGG - Intergenic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1156954723 18:42948602-42948624 TAGGACTCCTTGGGCAAACTGGG - Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG + Intronic
1161140000 19:2641565-2641587 TGGGGCTCCAGGGGAAAATCTGG - Intronic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1164668793 19:30061520-30061542 TGGGCCACCTTGGGAAGACCAGG - Intergenic
1164879206 19:31716657-31716679 TGGGCTTCCTTGGGGCAAACTGG + Intergenic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG + Intergenic
1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929554521 2:42917296-42917318 TGGGACTTTTTGGGCAGAACTGG + Intergenic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
931795110 2:65701016-65701038 TGTGCCTCGTTGGGTAAAACAGG + Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
941367449 2:164624484-164624506 TGGGATTCCTGAGGAAAGACAGG - Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG + Intronic
944726684 2:202478486-202478508 TGGGACTACTTTGGAAGTACGGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1171124017 20:22586386-22586408 TGGGACCCCGTGGGAAATGCTGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG + Intergenic
1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG + Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
953022287 3:39122490-39122512 TGGAACTCTTTGGGGAAAGCTGG - Intronic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
957874224 3:86124562-86124584 TGGAACTCCTAGGCAAAGACTGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960584268 3:119306225-119306247 TTGGACTCCTTGAGACAAAATGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG + Intronic
969280534 4:6167582-6167604 TGGGGCTCCTTGTTAAAAAATGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
978052110 4:104214191-104214213 TGGGACTACTTTGAAAAGACTGG - Intergenic
979299326 4:119068500-119068522 TAGGATTCCTTAGAAAAAACAGG - Intergenic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981770348 4:148300982-148301004 TGGGGCTCCATGAGGAAAACAGG - Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG + Intronic
986647245 5:9929531-9929553 TGGGACTCAGAGGGAAAATCAGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996488800 5:124067982-124068004 TGGGTCTCTTTGGGAAAGGCTGG + Intergenic
1003144870 6:3501540-3501562 TGGGACTCCTTCACATAAACAGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007478809 6:42136722-42136744 TGGGACTTGCTGGGAAAGACTGG - Intronic
1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG + Exonic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018195861 6:161355899-161355921 TGGGACTCGTTGGGTAAAGGGGG + Intronic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024812821 7:53234072-53234094 TGTCACTCCTTGGTCAAAACTGG - Intergenic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030274358 7:107703879-107703901 TGTTACTCATTGGGAGAAACTGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055018493 9:71644757-71644779 TAGGATTCCTTGTTAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060038931 9:120283168-120283190 TGGGACTCATTGGAAAAATTTGG - Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191692033 X:63950206-63950228 GGGGCCTGGTTGGGAAAAACAGG + Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic