ID: 1191619507

View in Genome Browser
Species Human (GRCh38)
Location X:63201241-63201263
Sequence TGGCAGGTCCTTCCACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191619507_1191619517 15 Left 1191619507 X:63201241-63201263 CCCACCAGTGGAAGGACCTGCCA No data
Right 1191619517 X:63201279-63201301 CCAGATTCTTTTGTCTCATGGGG No data
1191619507_1191619515 14 Left 1191619507 X:63201241-63201263 CCCACCAGTGGAAGGACCTGCCA No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619507_1191619514 13 Left 1191619507 X:63201241-63201263 CCCACCAGTGGAAGGACCTGCCA No data
Right 1191619514 X:63201277-63201299 CTCCAGATTCTTTTGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191619507 Original CRISPR TGGCAGGTCCTTCCACTGGT GGG (reversed) Intergenic
No off target data available for this crispr