ID: 1191619509

View in Genome Browser
Species Human (GRCh38)
Location X:63201245-63201267
Sequence TGAGTGGCAGGTCCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191619509_1191619514 9 Left 1191619509 X:63201245-63201267 CCAGTGGAAGGACCTGCCACTCA No data
Right 1191619514 X:63201277-63201299 CTCCAGATTCTTTTGTCTCATGG No data
1191619509_1191619515 10 Left 1191619509 X:63201245-63201267 CCAGTGGAAGGACCTGCCACTCA No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619509_1191619518 27 Left 1191619509 X:63201245-63201267 CCAGTGGAAGGACCTGCCACTCA No data
Right 1191619518 X:63201295-63201317 CATGGGGTGTTCCCTTGATGTGG 0: 15
1: 78
2: 144
3: 215
4: 320
1191619509_1191619517 11 Left 1191619509 X:63201245-63201267 CCAGTGGAAGGACCTGCCACTCA No data
Right 1191619517 X:63201279-63201301 CCAGATTCTTTTGTCTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191619509 Original CRISPR TGAGTGGCAGGTCCTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr