ID: 1191619515

View in Genome Browser
Species Human (GRCh38)
Location X:63201278-63201300
Sequence TCCAGATTCTTTTGTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191619507_1191619515 14 Left 1191619507 X:63201241-63201263 CCCACCAGTGGAAGGACCTGCCA No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619511_1191619515 -2 Left 1191619511 X:63201257-63201279 CCTGCCACTCAAGGCCTGCTCTC No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619512_1191619515 -6 Left 1191619512 X:63201261-63201283 CCACTCAAGGCCTGCTCTCCAGA No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619508_1191619515 13 Left 1191619508 X:63201242-63201264 CCACCAGTGGAAGGACCTGCCAC No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data
1191619509_1191619515 10 Left 1191619509 X:63201245-63201267 CCAGTGGAAGGACCTGCCACTCA No data
Right 1191619515 X:63201278-63201300 TCCAGATTCTTTTGTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191619515 Original CRISPR TCCAGATTCTTTTGTCTCAT GGG Intergenic
No off target data available for this crispr