ID: 1191620382

View in Genome Browser
Species Human (GRCh38)
Location X:63209954-63209976
Sequence CCTTGGGACAAAGGAAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620382_1191620388 -10 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620388 X:63209967-63209989 TGTCCCAAGGTGGGCTATGATGG No data
1191620382_1191620391 12 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620382_1191620392 13 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620392 X:63209990-63210012 ACCCTGTCCCCCTTCTCTCAGGG No data
1191620382_1191620400 30 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620382_1191620394 14 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620394 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620382 Original CRISPR CCTTGGGACAAAGGAAGTAT GGG (reversed) Intergenic