ID: 1191620384

View in Genome Browser
Species Human (GRCh38)
Location X:63209955-63209977
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620384_1191620391 11 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620384_1191620400 29 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620384_1191620394 13 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620394 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG No data
1191620384_1191620392 12 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620392 X:63209990-63210012 ACCCTGTCCCCCTTCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620384 Original CRISPR ACCTTGGGACAAAGGAAGTA TGG (reversed) Intergenic