ID: 1191620390

View in Genome Browser
Species Human (GRCh38)
Location X:63209971-63209993
Sequence GGGTCCATCATAGCCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620390_1191620400 13 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620390_1191620402 27 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620402 X:63210021-63210043 CTCCACAGGATAGATTGTCAGGG No data
1191620390_1191620403 28 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620403 X:63210022-63210044 TCCACAGGATAGATTGTCAGGGG No data
1191620390_1191620394 -3 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620394 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG No data
1191620390_1191620392 -4 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620392 X:63209990-63210012 ACCCTGTCCCCCTTCTCTCAGGG No data
1191620390_1191620391 -5 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620390_1191620401 26 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620390 Original CRISPR GGGTCCATCATAGCCCACCT TGG (reversed) Intergenic