ID: 1191620391

View in Genome Browser
Species Human (GRCh38)
Location X:63209989-63210011
Sequence GACCCTGTCCCCCTTCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620390_1191620391 -5 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620384_1191620391 11 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620381_1191620391 17 Left 1191620381 X:63209949-63209971 CCATGCCCATACTTCCTTTGTCC No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620382_1191620391 12 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620387_1191620391 3 Left 1191620387 X:63209963-63209985 CCTTTGTCCCAAGGTGGGCTATG No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data
1191620389_1191620391 -4 Left 1191620389 X:63209970-63209992 CCCAAGGTGGGCTATGATGGACC No data
Right 1191620391 X:63209989-63210011 GACCCTGTCCCCCTTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620391 Original CRISPR GACCCTGTCCCCCTTCTCTC AGG Intergenic